case study on dengue fever

• Research article
• Open access
• Published: 20 September 2021

A study on knowledge, attitudes and practices regarding dengue fever, its prevention and management among dengue patients presenting to a tertiary care hospital in Sri Lanka

• K. P. Jayawickreme   ORCID: orcid.org/0000-0001-9503-2854 1 ,
• D. K. Jayaweera 1 ,
• S. Weerasinghe 1 ,
• D. Warapitiya 1 &
• S. Subasinghe 1  

BMC Infectious Diseases volume  21 , Article number:  981 ( 2021 ) Cite this article

18k Accesses

7 Citations

1 Altmetric

Metrics details

The World Health Organization (WHO) has ranked dengue as one of the top ten threats to Global health in 2019. Sri Lanka faced a massive dengue epidemic in 2017, the largest outbreak in the country during the last three decades, consisting of 186,101 reported cases, and over 320 deaths. The epidemic was controlled by intense measures taken by the health sector. However, the reported dengue cases and dengue deaths in 2019 were significantly higher than that of 2018. Deaths were mostly due to delay in hospitalization of severe dengue patients. The mortality of dengue hemorrhagic fever is 2–5% if detected early and treated promptly, but is high as 20% if left untreated.

A descriptive cross-sectional study was done among patients with dengue fever presenting to the Sri Jayawardenepura General Hospital during October 2019. Data was collected using a questionnaire comprising 20 questions based on knowledge, attitudes and practices on dengue, which were categorized into questions on awareness of mortality and severity of dengue burden, prevention of dengue vector mosquito breeding and acquiring the infection, patient’s role in dengue management, and warning signs requiring prompt hospitalization.

The mean KAP score on all questions was 55%, while a majority of 65.2% patients scored moderate KAP scores (50–75%) on all questions, and only 7.6% had high KAP scores (> 75%). The highest categorical mean score of 62% was on awareness of dengue prevention, followed by 54% on awareness of dengue burden, and only 51% on dengue management. Only 5.3% patients scored high scores on awareness of dengue management, followed by 28.5%, and 40.9% patients scoring high scores on awareness of dengue burden, and awareness of prevention of dengue respectively. The mean KAP scores on all questions increased with increasing age category.

The population relatively has a better awareness of dengue prevention, as compared to awareness of dengue mortality and dengue management. The identified weak point is patient awareness of the patients’ role in dengue management, and identifying warning signs requiring prompt hospitalization. This results in delay in treatment, which is a major cause for increased mortality. There was a correlation between those who had good knowledge on dengue burden and those who were aware of patients’ role in dengue management. An action plan should be implemented to improve public awareness through education programs on the role of the public and patients in dengue management to drive a better outcome.

Peer Review reports

The World Health Organization (WHO) has ranked dengue as one of the top ten threats to Global health in 2019 [ 1 ]. Brady et al. estimates a 3.9 billion prevalence of people, accounting to 40%-50% of the world’s population being at risk of infection. 128 countries worldwide are at risk of dengue infection, of which 70% of the global burden being in Asia [ 2 , 3 ]. The reported dengue cases to WHO increased from < 0.5 million in 2000 to > 3.34 million in 2016, characterized by a worldwide outbreak [ 4 ]. Although the world-wide numbers declined in 2017, there was a significant rise again in 2019 with 4.3 million cases worldwide. The highest number of dengue cases worldwide in 2019 in descending order were reported in Brazil, Philippines, Vietnam, Mexico, Nicaragua, Malaysia and India respectively, with Sri Lanka being placed in the 8th place worldwide, and in the 5th place in Asia [ 5 ]. Following a steady rise in annual dengue cases, Sri Lanka faced a massive dengue epidemic in 2017, which was the largest outbreak in the country during the last three decades, consisting of 186,101 reported cases, and over 320 deaths. The epidemic was controlled by intense measures taken by the health sector. However, the reported dengue cases rose again in 2019 reaching 102,746, being twice the number of reported cases of 51,659 in 2018, indicating re-emergence of an outbreak in 2019. A majority of cases being in the western province, with 20% in the Colombo district [ 6 ]. The dengue deaths in 2019 were 90; higher than the total dengue deaths in 2018 being 58, albeit with reduced mortality rate per overall cases [ 6 , 7 ]. The mortality of dengue fever is < 1%, and that of dengue hemorrhagic fever is 2–5% if detected early and treated promptly, but is high as 20% if dengue hemorrhagic fever is left untreated [ 8 ].

Dengue virus is a flavivirus transmitted by mosquito vectors, such as Aedes aegypti and Aedes albopictus. Dengue fever was first serologically confirmed in Sri Lanka in 1962 [ 9 ]. All four serotypes of dengue virus, DENV-1 to DENV-4 have been circulating in the country, and each serotype has many genotypes [ 9 ]. The most common cause for occurrence of new epidemics is the shift of the circulating serotype and genotype of the dengue virus, which is predisposed by increased foreign travel introducing new strains [ 9 ]. The dengue outbreak in 2003 was predominantly due to DENV-3 and DENV-4. The outbreaks in 2006, 2009 and 2010 was predominantly due to DENV-1 [ 9 ]. The predominant serotype in the 2017 epidemic was DENV-2 which was infrequent since 2009 [ 10 ]. The outbreak in 2019 was predominantly due to previously latent serotype DENV-3 [ 11 ].

The WHO published and implemented a “Global Strategy for Dengue Prevention And Control” targeting the years from 2012 to 2020, with the goals of improving dengue mortality, and morbidity by the year 2020, and estimating the true disease burden. The main elements of the global strategy were diagnosis and case management, integrated surveillance and outbreak preparedness, sustainable vector control, future vaccine implementation, basic operational and implementation research [ 12 ].This global strategy follows 10 priority areas for planning dengue emergency response, adapted from Rigau-Pérez and Clark in 2005, which also includes Engaging the community and relevant professional groups about dengue control as well as their participation in dengue prevention and control [ 13 ].

A recent study in Malaysia, showed that the population had only an average knowledge, and poor attitudes and practices on dengue prevention. They identified that a significant percentage had erroneous beliefs, such as fogging being the mainstay of dengue vector control. It had led them to a false sense of security, while evading actual measures that should be taken. They also identified that a proportion of people believed they had no responsibility in preventing dengue breeding, which needed urgent attention. They highlighted that it was impossible to reduce dengue prevalence without community participation, and concluded that measures were urgently required to educate the public to change their attitudes. The Communications for behavioral changes program on dengue prevention were subsequently implemented by Health departments of Malaysia to improve dengue awareness and prevention [ 14 ].

Although there had been a few studies on public awareness on dengue prevention, there was limited evidence focused on public awareness on their role in dengue prevention and management. It is therefore very important to take active measures to reduce the incidence and mortality of dengue, for which the responsibility lies not only with health professionals, but also with the general public. The purpose of this study is to identify the level of awareness in patients on preventing and managing dengue infection, and awareness of the patient’s role and responsibility in the above. Our goals were to identify areas in dengue control and management that need improvement, to implement policies that raise patient participation to deliver a better outcome of dengue infection, its complications and its management.

Study design

This is a descriptive cross-sectional study assessing the knowledge, attitudes, and practices on dengue fever, its prevention and the patient’s role in management, among the dengue patients presenting to a tertiary care hospital in Sri Lanka during the month of October 2019.

Study setting

The study was done among a random sample of 132 patients with dengue fever or dengue hemorrhagic fever who were admitted to adult medical wards for treatment at the Sri Jayawardenepura General Hospital during October 2019. These patients comprised people from draining areas of the western province of Sri Lanka.

Sample size

The number of patients who presented to the Sri Jayawardenepura General hospital in the month of October 2019 was 200. A sample size of 132 was calculated with a confidence interval of 95%, to match the population to assess a statistically significant result.

Participants

The study population was randomly selected among adult patients older than 13 years of age admitted with dengue infection to the medical wards of the Sri Jayawardenepura General Hospital during the month of October 2019.

Participants were not selected from the same family who would likely to be influenced by similar knowledge, to avoid bias of pseudo-replication.

Data collection

Data collection was commenced after obtaining the approval from the institutional Ethical Review committee of the Sri Jayawardenepura General Hospital and Postgraduate Training Centre (SJGH/20/ERC/017). Data was collected using a self-administered validated questionnaire regarding Knowledge, Attitudes, and Practices (KAP) on dengue in languages English, Sinhala, and Tamil which were translated and extensively reviewed for validation (Additional file 1 : Appendix S1, Additional file 2 : Appendix S2, Additional file 3 : Appendix S3).

Data was collected from randomly selected participants, only after informed written consent was obtained. The questionnaires were filled by the participants themselves using the validated questionnaire of the language convenient to them. The study investigators were with them while filling the questionnaire in case the participants needed to clarify any questions in order to ensure quality. The data was collected anonymously, while strict confidentiality of the responses and the results was maintained.

The questionnaire consisted of 20 questions which, comprised 5 questions on knowledge, 6 questions on attitudes, and 9 questions on practices on dengue fever and haemorrhagic fever, its prevention and patient’s role in management. Prior to analysis they were then re-categorized into questions on awareness of:

mortality and severity of dengue burden—5 questions

prevention of dengue vector mosquito breeding and acquiring the infection—5 questions

patient’s role in dengue management, and warning signs requiring prompt hospitalization—10 questions

The responses to each question was analyzed with percentage estimated of correct responses. The total marks scored by each participant to the whole questionnaire was estimated as a percentage, which has been defined as the “KAP score”. KAP score is an abbreviation used for the total score of the questions based on K nowledge, A ttitudes, and P ractices regarding dengue burden, dengue prevention and management in this study. The total results were categorized as “low” when KAP were < 50%, “moderate” when KAP scores were 50–75%, and “high” when KAP scores were > 75%.

Statistical methods

Data was analyzed using the SPSS (Statistical Package for the Social Sciences) software. All the questionnaire sheets were filled completely and none of the sheets were excluded. The mean of the KAP score of each category was calculated. The percentage of the population who scored low, moderate and high KAP scores was calculated separately. The responses to each of the 20 questions were analyzed separately to infer the areas which needed further improvement in awareness of the general public on dengue.

The study population comprised 61% males, and 39% females with a male: female ratio of 3:2. When categorizing by age, 42% of the study population was less than 30 years old, 36% were between 30 and 50 years old, and 22% were more than 50 years old. Of those who were between 30 and 50 years, 35% were graduates or diploma holders. Of those who were more than 50 years old, 21% were graduates or diploma holders. When categorizing by level of education, 10% of the population was currently schooling, 8% were adults educated up to less than ordinary level (O/L) at school who were not graduates or diploma holders, 18% were adults educated up to O/L at school who were not graduates or diploma holders, 34% were adults educated up to advanced level (A/L) at school who were not graduates or diploma holders, 24% were adults who had completed school education and were undergraduates, 6% were adults who had completed school education and were graduates or diploma holders (Table 1 ).

The mean KAP score of the sample population from the questionnaire was 55.04%. When categorizing the KAP scores as low (< 50%), moderate (50–75%), and high (> 75%), a majority of 65.2% of the population had moderate KAP scores. 27.3% had low KAP scores, and only 7.6% had high KAP scores (Fig. 1 ).

Percentage of the study population who scored under each KAP score level Category. When categorizing the KAP scores as low (< 50%), moderate (50–75%), and high (> 75%) scores, a majority of 65.2% of the population had moderate KAP scores. 27.3% had low KAP scores, and only 7.6% had high KAP scores

The KAP score achieved was higher with increasing age. The highest mean total KAP score of 57.86% was among those > 50 years of age, with those aged < 30 years having a mean KAP score of 53.48% and those aged 30–50 years having a mean KAP score of 55.21% (Fig. 2 ). The mean KAP score on awareness of dengue mortality and burden among the age categories < 30 years, 30–50 years, and > 50 years was 49.29, 56.88, and 58.57% respectively. The mean KAP score on awareness on prevention of dengue vector breeding and acquiring the infection among the age categories < 30 years, 30–50 years, and > 50 years was 63.57, 59.38, and 63.57% respectively. The mean KAP score on awareness of patients’ role in dengue management and warning signs requiring prompt hospital admission among the age categories < 30 years, 30–50 years, and > 50 years was 49.82, 52.08, and 51.79% respectively (Fig. 3 ).

The mean KAP score of each age category. The KAP score achieved was higher with increasing age. The highest mean KAP score of 57.86% was among those > 50 years of age, with those aged < 30 years having a mean KAP score of 53.48% and those aged 30–50 years having a mean KAP score of 55.21%

Comparison of the total KAP score, awareness on mortality and severity ofdengue burden, awareness on prevention of dengue vector breeding and acquiring the infection, and awareness on patient’s role in dengue management, and warning signs requiring prompt hospitalization under each age category

The mean KAP score was higher among those with higher educational qualification levels. The highest mean KAP score of 58.13% was among graduates and professional diploma holders of any field, and the lowest score of 49% was among adults educated in school up to below O/L. The mean total KAP score among those currently schooling was 54.62%. Adults who were not undergraduates, graduates, or diploma holders, who were out of school, but were educated at school up to O/L and those who had completed schooling after A/L had mean total KAP scores of 53.96 and 54.67% respectively. The mean KAP score on awareness of dengue mortality and severity of dengue burden among each of the age categories; schooling, adults educated less than O/L, adults educated up to O/L, adults educated up to A/L, under graduates, graduates or diploma holders were 50.77, 42, 60.83, 50.44, 58.75, and 55% respectively. The mean KAP scores on awareness on prevention of dengue vector breeding and acquiring the infection among each of the educational categories in above order were 60, 60, 60, 64, 60.94, 67.5% respectively. The mean KAP scores on awareness of the patient’s role in dengue management and warning signs requiring prompt hospital admission among each of the educational categories in above order were 53.85, 45, 44.58, 51.56, 55, 55% respectively (Fig. 4 ). The mean KAP score among females was 55.48%. and that of males was 54.75%.

Comparison of the total KAP score, awareness on mortality and severity of dengue burden, awareness on prevention of dengue vector breeding and acquiring the infection, and awareness on patient’s role in dengue management, and warning signs requiring prompt hospitalization under each educational category

When analyzing data by categorizing the questions by the awareness on the area assessed, the highest mean KAP score of 62.05% was on questions on awareness of prevention of dengue vector breeding and acquiring the infection, while the lowest mean KAP score of 51.06% was on questions on awareness of patient’s role in dengue management, and warning signs requiring prompt hospitalization. The mean KAP score on awareness of dengue mortality and severity of burden was 54.02% (Fig. 5 ). On analysis of questions related to awareness of dengue mortality and severity of burden, only 28.8% had high KAP scores, 40.9% had low KAP scores, and 30.3% had moderate KAP scores. On the analysis of questions related to awareness on dengue prevention, an equal percentage of 40.9% had low and high KAP scores respectively, and 18.2% had moderate KAP scores. Analysis of questions related to awareness on patient’s role in dengue management and warning signs prompting hospitalization showed, only 5.3% had high KAP scores, 62.9% had moderate KAP scores, and 31.8% had low KAP scores (Fig. 6 ).

Mean KAP score of each area assessed. 1. Mean KAP score on awareness of mortality and severity of dengue burden- 54%. 2. Mean KAP score on awareness of prevention of dengue breeding and acquiring the infection—62%. 3. Mean KAP score on awareness of patient’s role in dengue management, and warning signs requiring prompt hospitalization—51%

Comparison of percentage of the population who scored low (< 50%), moderate (50%-75%), and high (> 75%) KAP scores under each area assessed

There is no statistically significant correlation between the mean KAP scores on awareness of dengue mortality and severity of dengue burden, and the mean KAP scores on awareness on prevention of dengue vector breeding and acquiring infection according to the spearman’s test (p = 0.084). Although there is a statistically significant correlation between the mean KAP scores on awareness of dengue mortality and severity of dengue burden, and the mean KAP scores on awareness of patient’s role in dengue management and warning signs requiring prompt hospital admission according to the spearman’s test (p = 0.015).

The populations response to each individual question is shown in Table 2 . The percentage of the population who knew the correct answer for the questions on awareness of dengue burden and mortality were as follows: The number of reported dengue cases in Sri Lanka for the year during the outbreak in 2017 was close to 200,000 (42%), The number of reported dengue cases in the year 2019 is higher than that of 2018 (52%), Of 100 persons who get dengue fever only 1 or less persons would die per year when detected early and proper access to medical care (The mortality of dengue fever is < 1%) (60%), The mortality rate of dengue hemorrhagic fever is 2–5%, but is high as 20% if left untreated (60%), The WHO has ranked dengue as one of the top ten threats to Global health in 2019 (56%).

The percentage of the population who knew the correct answer for the questions on awareness of dengue prevention were as follows: all persons with dengue fever do not need to be notified to the Public Health Inspector (PHI) (39%), dengue vector mosquitoes breed in muddy water (52%), The peak biting times of the dengue mosquito is morning and evening (80%), If a person gets dengue fever once in their life, they will be immune to it and will not get dengue fever again (44%), discarded tires, coconut shells, and plastic containers collecting rain water in the garden should be destroyed to prevent dengue vector breeding (96%).

The percentage of the population who knew the correct answer to the questions on awareness of dengue management and warning signs which require prompt hospitalization were as follows: There is a special drug available to treat dengue fever (43%), papaya leaf juice increases the platelet count and thus helps treat dengue fever (33%), dengue patients with a platelet count < 150,000/mm 3 with a rapid drop are recommended to be admitted to hospital (85%), abdominal pain in a dengue patient is not an indication for hospital admission (32%), all pregnant mothers with dengue fever are recommended to be admitted in hospital irrespective of the platelet count (83%), NS1 antigen can be tested on any day since the onset of fever to diagnose dengue fever (23%), a negative report of dengue IgM antibody done on the second day since onset of fever means the patient does not have dengue fever (17%), When a dengue patient has a platelet count > 150,000/mm3 and does not meet criteria which require hospital admission, they should drink 2500 ml of oral fluids per day at home (40%), When a dengue patient has a platelet count > 150,000/mm3 and does not meet criteria which require hospital admission, they should check their Full blood count daily to assess the drop in platelet count (65%), dengue patients should avoid having red or brown drinks (89%).

Dengue virus has four serotypes. Acquisition of dengue infection due to one serotype does not give immunity against a subsequent infection with another serotype, though there is about a two years period of cross-protection [ 15 ]. All four serotypes share only 60–75% identity at amino acid level, and are thus considered as different viruses [ 14 ]. Infection from one serotype gives life-long immunity against that particular serotype [ 10 , 15 ]. Once the cross protection wanes off, secondary dengue infection is more severe than primary dengue infection [ 10 , 15 ]. However only 44% of the study population were aware that occurrence of dengue infection once, does not prevent occurrence of the disease again.

Dengue transmission increases during the rainy season in Sri Lanka, mostly in July, due to increasing dengue vector mosquito breeding places. Other causes for increase in the number of dengue cases is urbanization, climate change, and poor vector control and prevention of disease [ 10 ]. 96% of our cohort were aware of the need to destroy and clean water collecting areas, to prevent breeding of the dengue vector, while 84% of the cohort of a similar study done in the central province of Sri Lanka was aware of this same fact. This is probably because the latter study was done in 2015, prior to the dengue epidemic in 2017 [ 16 ]. Intense measures were taken in the country by which the epidemic in 2017 was controlled. This included clean-up campaigns, awareness programs, National dengue prevention and control, National Strategic framework (2016–2020) to align their action with the WHO Global strategy for dengue prevention and control (2012–2020), The Presidential Task Force on Dengue (PTF) and National dengue control unit of the Ministry of Health launched a rapid inter-sectoral program for prevention and control of dengue [ 7 ]. Awareness programs were held in rural and urban community gatherings, taught in school and institutions, shared on social media, television and radio [ 7 ]. However, data regarding the targeted population for these awareness programs was sparse. Dengue is ranked the third commonest notifiable disease in Sri Lanka, by which means the health sector can implement active vector control measures in the identified areas [ 17 ]. Only 39% of the study population was aware that all persons with dengue fever should be notified to the PHI. The low number of people who were aware of the importance of notifying dengue cases to the PHI, was probably due to the general public being unaware of the PHI’s role in dengue prevention, and lack of awareness of their responsibility in notifying cases, and it’s importance in vector control. Lack of notification of disease hinders action taken for vector control, which gives a falsely lower number of reported cases than the actual number. People should be educated on this to improve notification and vector control. Notification to the PHI of dengue patients managed at home or in the hospital should be made mandatory to avoid negligence in notification. This study population had a relatively good awareness about dengue breeding sites and biting times, probably due to awareness programs during the 2017 epidemic. Literature has shown the importance of improving knowledge on dengue prevention to control dengue outbreaks [ 18 ].

A study in Vietnam during the dengue epidemic in 2017 showed that 91% of the study population considered dengue to be dangerous to very dangerous [ 19 ]. Our study evaluated patients already being admitted for treatment of dengue at the Sri Jayawardenepura general hospital, comprising of patients from the western province, which has the highest dengue burden in the country. A similar study was done in the central province of Sri Lanka by Jayalath et al . among out patients visiting the Peradeniya hospital for reasons other than dengue. Jayalath et al. showed that 95% of their study population knew dengue was a severe disease [ 16 ]. 75% of the cohort of a similar study done among patients being admitted for treatment of dengue fever, in the northern province of Sri Lanka in 2017, knew that dengue was a severe disease [ 20 ]. Our study population had a moderate mean KAP score (54%) on questions on awareness on dengue severity and burden. 40.9% of the population had low awareness on severity and burden of dengue, and only 28.8% had high awareness on its severity and burden. This difference in evidence regarding awareness of severity of dengue in the above studies, could be because the questions by which awareness was evaluated was different in the three studies, and because our study, and the study in the northern province evaluated patients who had already acquired dengue fever and were admitted for treatment at that time. It could also be speculated that these populations acquired dengue infection due to their lack of awareness in prevention of disease.

This lack of awareness on the severity of dengue and it’s burden is probably due to most dengue patients uneventfully recovering from uncomplicated dengue fever, and due to successful dengue management by the healthcare system in the country. This study identified that those who had good awareness on the mortality and severity of the burden of dengue, also had a good awareness about their role in managing dengue, as well as warning signs requiring prompt hospital admission. It can be concluded that there is a strong correlation between those who have an appreciation of the gravity of the symptoms caused by dengue, and the likelihood of them educating themselves on dengue management and their active participation in it. Rozita et al. showed that people who were infected by dengue, or had a family member infected by the disease had better knowledge, attitudes and practices about dengue compared to those who did not [ 21 ]. A study in Singapore in 2017 after the country’s largest dengue epidemic showed that attitudes and practices regarding dengue among primary care physicians significantly improved after experiencing the epidemic [ 22 ]. Chanthalay S et al . showed that those who had better knowledge and attitudes regarding dengue are more likely to take precautions to prevent the disease [ 23 ]. Those who have good awareness will have a good understanding of the gravity and impact of the disease, will know the importance of preventing it, and will be aware of necessary preventive measures.

The mortality of dengue fever is < 1%, and that of dengue hemorrhagic fever is 2–5% if detected early and treated promptly, but is high as 20% if dengue hemorrhagic fever is left untreated [ 8 ]. In 2015 Malhi et al. reported that the presence of comorbidities like diabetes mellitus, hypertension, chronic kidney disease, allergies, asthma, ischemic heart disease and hepatic anomalies, as well as delay in identification and treatment were linked to increased mortality from dengue [ 24 ]. However, in 2017 a study by the same authors showed that 50% of dengue deaths were of previously healthy individuals with no comorbidities [ 25 ]. Therefore, the leading cause for dengue related complications and deaths is delayed identification and treatment of disease. This can be due to delays by the patient or health staff, mostly due to delayed patient presentation to the hospital [ 26 ].Studies have shown that late presentation of dengue fever to the hospital leads to increased development of dengue haemorrhagic fever, dengue shock syndrome, multi-organ involvement like acute kidney injury, and increased mortality [ 26 , 27 , 28 ]. According to the study findings, by identifying areas where the public has misconceptions and misunderstandings about dengue fever, its prevention and management, we can implement steps to improve those loop holes. By following correct practices, avoiding malpractices, and timely hospital admission, his will reduce dengue fatality, improve the outcome, and will also reduce the burden on the healthcare system.

The national Guidelines on dengue management indicates the need for hospital admission in a dengue patient if the platelet count is < 100,000, or platelet count between 100,000- 150,000 with a rapid drop in platelets, fever for three days with any warning signs such as abdominal pain, persistent vomiting, mucosal bleeding, lethargy and restlessness [ 29 ]. Irrespective of the above criteria, admission is required in dengue patients who are pregnant, elderly, obese, with comorbidities, or with adverse social circumstances [ 29 ]. In this study, 85 and 83% patients respectively were aware of the indication for admission as per the platelet count or if pregnant, but only 32% patients knew admission was indicated with warning signs like abdominal pain. Therefore, people need to be educated about warning signs of severe dengue infection. People who do not require admission must be educated about cautious self-management at home until they require admission [ 29 ]. By doing so there will be less likelihood to miss warning signs, will have improved outcome, and there will be less burden to hospital staff. Only 40% of patients knew about fluid management at home, but 89% knew to avoid red drinks.

Serological testing is important to confirm the diagnosis of dengue fever when the presentation is atypical or when unsure of the diagnosis. NS1 antigen is tested in the patient’s blood on the first few days of the disease and has a sensitivity of 60–90%. Dengue IgM antibody will be positive in the patient’s blood only after the 5th day of illness [ 29 ]. Therefore, patients should be educated about the ideal time to do each test to avoid false negatives being reported by doing the test at the wrong time of the illness. However, dengue infection cannot be excluded by a negative serological lab report. Few patients knew about the timing of testing, with only 23% and 17% being aware of the timing of testing, and sensitivity of NS1 antigen and dengue IgM respectively. It is important that health care professionals guide patients on the correct timing to do the serological tests. It would be prudent to do such serological tests only on request by a physician, to avoid patients testing at the wrong time, and getting a report which cannot be interpreted at that time of the illness. False negatives of serological testing can further be avoided by laboratory staff rechecking the patients’ day of the illness, and the physicians request form prior to drawing blood.

This study shows that people had misconceptions about dengue management. Only 43% knew there was no special drug to treat dengue fever. There is no particular drug to treat dengue, but is managed by careful monitoring and fluid tailoring resuscitation [ 29 ]. A tetravalent live attenuated dengue vaccine has been registered for use in several countries [ 15 ]. In sero-negative individuals it is believed that the vaccine mimics a silent natural infection, giving temporary cross-protection against all serotypes, and subsequently causing severe dengue infection when primarily infected [ 15 ]. However, its efficacy varies in different countries and is not currently recommended for use in Sri Lanka [ 15 ]. The use of papaya leaf juice in dengue management had recently gained interest, leading to many people consuming the juice assuming improvement of dengue infection. Research has shown papaya leaf juice to improve platelet counts, but has not shown to prevent or reduce fluid leaking in dengue hemorrhagic fever [ 30 ]. This can adversely cause early rise in platelet count masking the onset of fluid leaking, which can be detrimental in managing dengue hemorrhagic fever. 33% of our cohort believed papaya leaf juice helped treat dengue fever, while 13.4% of the cohort in a study done in Sri Lanka in 2015 believed the same to be true. This is probably because the concept of the effect of papaya leaf juice on platelet count came in to light only later on [ 16 ].

This study demonstrated an increasing trend in awareness on all categories, such as among people with a higher level of education, and maturity by age, indicating that education and maturity are important factors for improved awareness. Kumanan et al. showed a significant association between educational level and knowledge regarding dengue fever, and no significant association between educational level and preventive practices [ 20 ]. The trend in our study demonstrated on Fig. 3 suggests that responses in the awareness on dengue mortality and severity of dengue burden steadily increased with age, and strongly influence the mean total KAP scores. The highest awareness in all age categories was on dengue prevention and the lowest awareness in all categories was on patients’ role in dengue management and warning signs requiring prompt hospitalization (Fig. 3 ).

There was inadequate awareness among adults who dropped out of school prior to completion of the full school education up to advanced level even when they are older. This may demonstrate a population with lower level of understanding of the information given, and those who were not regularly educated at school regarding dengue infection as they dropped out. Those who drop out of school are also those who usually have a poor social background, and they may also have inadequate access to social media and electronic media to receive updates about dengue mortality, prevention and management. This highlights the need for any information to reach the people of all social backgrounds when implementing strategies to improve public awareness on dengue infection. Dissemination of information should be done in various ways targeting different populations of different levels of understanding. People with lower education levels should be the main target group requiring more advice and education regarding the patient’s role in dengue management.

This population has a relatively a better awareness on dengue prevention as compared to awareness of dengue mortality and dengue management. This is possibly due to prior media education of the public on prevention during the previous epidemic in 2017. The identified weak point is patient awareness on the patient’s role in dengue management, as well as identifying warning signs requiring prompt hospitalization. It causes delay in treatment, which is a major cause for increased mortality. The trend demonstrated on Fig. 5 suggests that responses in the dengue management and warning signs prompt hospitalization area strongly influence the total KAP scores. This indicates that patient awareness on the role of the public and patients on dengue management is critical in the outcome of dengue infection. An action plan should be implemented targeting improving public awareness by education programs on the role of the public and patients in dengue management, to improve outcome.

The general public play a major role in prevention and management of dengue fever, and influence the outcome. Jayalath et al. showed that 30% of their population believed the responsibility of dengue prevention lay with the public, while 66% believed both the public and the government were responsible [ 16 ]. In order to improve involvement of patients and the public in dengue prevention, control and management, attention should be paid on educating the public and patients on the disease.

Limitations and recommendations for future research

This study focused on 132 patients from one hospital. Therefore, the conclusions can be relevant only to draining areas in the vicinity of this hospital, and may not represent the knowledge, attitudes and practices in other parts of Sri Lanka. However, since majority of the dengue cases in the country are concentrated in the western province, of which a significant number of patients present to the Sri Jayawardenepura General Hospital, the findings of this study may represent the most dengue dense area in the country. Large scale future research from all parts of the country may be beneficial to infer the knowledge, attitudes, and practices of the country as whole.

The general public was educated about Dengue infection by various means, including messages on social media, electronic media, awareness programs at schools, and village meetings, posters and distribution of leaflets, during the dengue epidemic in 2017. This study did not extensively evaluate whether the study participants had been exposed to these prior teaching about Dengue infection, and if they did, by what means they were educated. However almost all the study participants had access to electronic and social media. This may not be the same when inferring on the population in some rural parts of Sri Lanka who may not have similar access to such media education. Awareness programs and active participation of the general public in dengue prevention and management should be implemented. We suggest future follow up research of the awareness on dengue infection among the public, before and after implementing formal dengue awareness strategies to assess the effectiveness of it. In addition to follow up research before and after implementing disease awareness steps, we also suggest future research to assess an association and comparison of dengue mortality and outcome before and after implementing practices to further educate the public, in order to identify its impact on dengue management and outcome.

The population has relatively a better awareness on dengue prevention, as compared to awareness of dengue mortality and dengue management. The identified weak point is patient awareness on the patient’s role in dengue management, and identifying warning signs requiring prompt hospitalization causing delay in treatment, which is a major cause for increased mortality. There was a correlation between those who had good knowledge on dengue burden and those who were aware of the patients’ role in dengue management. There is also an increasing trend in awareness on all categories, especially among people with a higher level of education, and maturity by age, indicating that education and maturity are important factors for improved awareness. An action plan should be implemented targeting improving public awareness on the role of the public and patients in dengue management to improve outcome.

Availability of data and materials

The raw data sets analyzed during the current study are available on reasonable request from the corresponding author.

Abbreviations

Dengue virus

Knowledge attitudes and practices

Ordinary level at school

Advanced level at school

Ten threats to global health in 2019. World Health Organization. https://www.who.int/emergencies/ten-threats-to-global-health-in-2019 . Accessed 4 Jan 2020.

Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013;496(7446):504–7.

Article   CAS   Google Scholar  

Brady OJ, Gething PW, Bhatt S, Messina JP, Brownstein JS, Hoen AG, et al. Refining the global spatial limits of dengue virus transmission by evidence-based consensus. PLoS Negl Trop Dis. 2012;6(8):e1760.

Article   Google Scholar  

Dengue and severe dengue. World health organization.4th November 2019. https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue . Accessed 4 Nov 2019.

Dengue worldwide overview 2019. European Centre for Disease Prevention and Control. https://www.ecdc.europa.eu/en/dengue-monthly . Accessed 4 Jan 2020.

Epidemiology unit, Ministry of Health Sri Lanka. Dengue, disease surveillance trends. http://www.epid.gov.lk . Accessed 4 Jan 2020.

Dengue DREF final report 2017. Dengue Sri Lanka. International federation of red cross and red crescent societies. https://www.chrome-extension://efaidnbmnnnibpcajpcglclefindmkaj/viewer.html?pdfurl=https%3A%2F%2Freliefweb.int%2Fsites%2Freliefweb.int%2Ffiles%2Fresources%2FMDRLK007dfr.pdf&clen=1774569&chunk=true . Accessed 4 Jan 2020.

Lahiri M, Fisher D, Tambyah PA. Dengue mortality: reassessing the risks in transition countries. Trans R Soc Trop Med Hyg. 2008;102(10):1011–6.

Sirisena PDNN, Noordeen F. Evolution of dengue in Sri Lanka—changes in the virus, vector, and climate. Int J Infect Dis. 2014;19:6–12.

Jayarajah U, Faizer S, de Zoysa I, Senevirathne SL. A large Dengue epidemic affects Sri Lanka in 2017. IJPSAT. 2017;6(1):84–6.

Google Scholar  

National Dengue control unit. Ministry of Health, Nutrition, and Indigenous Medicine. http://www.dengue.health.gov.lk . Accessed 4 Jan 2020.

World Health Organization. Global strategy for dengue prevention and control 2012–2020. Geneva: World Health Organization

Rigau-Pérez JG, Clark GG. Còmo responder a una epidemia de dengue: vision global y experiencia en Puerto Rico [How to respond to a dengue outbreak: global vision and experience in Puerto Rico]. Pan Am J Public Health. 2005;17:282–93.

Selvarajoo S, Liew JWK, Tan W, et al. Knowledge, attitude and practice on dengue prevention and dengue seroprevalence in a dengue hotspot in Malaysia: a cross-sectional study. Sci Rep. 2020;10(1):9534. https://doi.org/10.1038/s41598-020-66212-5 .

Article   CAS   PubMed   PubMed Central   Google Scholar  

Applicability of dengue vaccines. Weekly epidemiological report. Apublication of the Epidemiological unit, Ministry of Health, nutrition and indigenous medicine, Sri Lanka. 18th - 24th March 2017. Volume 44. no. 12. https://www.chrome-extension://efaidnbmnnnibpcajpcglclefindmkaj/viewer.html?pdfurl=http%3A%2F%2Fwww.epid.gov.lk%2Fweb%2Fimages%2Fpdf%2Fwer%2F2017%2Fvol_44_no_12-english.pdf&clen=1799202&chunk=true . Accessed 6 Jan 2020.

Jayalath T, Ralapanawa U, Karunaratne S, Dassanayake UKA, Pathirage M, et al. Knowledge and attitude regarding dengue fever among the outdoor patients of the teaching hospital Peradeniya, Sri Lanka. Int J Med Res Health Sci. 2018;7(1):77–84.

Annual health bulletin of Sri Lanka. Department of Health Services, Colombo, Sri Lanka (2002)

Al-Zurfi BM, Fuad MD, Abdelqaderm MA, Baobaidm MF, Elnajehm M, Ghazim HF, Ibrahim MH, Abdullah MR. Knowledge, attitude and practice of dengue fever and health education programme among students of Alam shah science school, Cheras Malaysia Malays. J Public Health Med. 2006;6:62–7.

Nguye HV, Than PQT, Nguyen TH, Vu GT, et al. Knowledge, attitude and practice about dengue fever among patients experiencing the 2017 Outbreak in Vietnam. Int J Environ Res Public Health. 2017;2019(16):976.

Kumanan T, Logeswaran D. A study on knowledge, attitude and practices regarding dengue among hospitalized patients from Northern Sri Lanka. Sri Lankan J Infect Dis. 2018;8(2):127–32. https://doi.org/10.4038/sljid.v8i2.8220 .

Wan Rozita WM, Yap BW, Veronica S, Muhammad AK, Lim KH, Sumarni MG. Knowledge, attitude and practice (KAP) survey on dengue fever in an urban malay residential area in Kuala Lumpur. Malays J Public Health Med. 2006;6:62–7.

Junxiong P, ZoeJane-Lara H, Tun LH, Jing Y, Yee SL. Assessing changes in knowledge, attitude and practices of dengue diagnosis and management among primary care physicians after the largest dengue epidemic in Singapore. BMC Infect Dis. 2017;17:428.

Chanthalay S, Jiraporn C, Somsak W, Cheerwith R. Knowledge, attitudes and preventive behaviours related to dengue vector breeding control measures among adults in communities of Vientiane, capital of Lao PDR. J Infect Public Health. 2015;8:466–73.

Mallhi TH, Khan AH, Adnan AS, et al. Clinico-laboratory spectrum of dengue viral infection and risk factors associated with dengue hemorrhagic fever: a retrospective study. BMC Infect Dis. 2015. https://doi.org/10.1186/s12879-015-1141-3 .

Article   PubMed   PubMed Central   Google Scholar  

Mallhi TH, Khan AH, Sarriff A, Adnan AS, Khan YH. Determinants of mortality and prolonged hospital stay among dengue patients attending tertiary care hospital: a cross-sectional retrospective analysis. BMJ Open. 2017;7(7):e016805.

Mallhi TH, Adnan AS, Khan AH, Habib Y, et al. Patients related diagnostic delay in dengue: an important cause of morbidity and mortality. Clin Epidemiol Glob Health. 2016;4(4):200–1.

Yatra IM. Disease history and delayed diagnosis of dengue infection as risk factors for dengue shock syndrome in Wangaya Hospital Denpasar. Public Health Prev Med Arch. 2015. https://doi.org/10.15562/phpma.v3i2.108 .

Nguyen Thi KT, Nguyen Ngoc AT, Khau MT, Nguyen TT, Luong CQ. Epidemiology analysis of deaths associated with dengue hemorrhagic fever in Southern Viet Nam in 1999–2000. Dengue Bull. 2001;25:28–32.

Guidelines on the management of dengue fever and dengue haemorrhagic fever in adults. National Guidelines 2012. Ministry of Health, Sri Lanka.

Rajapakse S, de Silva NL, Weeratunga P, et al. Carica papaya extract in dengue: a systematic review and meta-analysis. BMC Complement Altern Med. 2019;19:265. https://doi.org/10.1186/s12906-019-2678-2 .

Download references

Acknowledgements

We all express our gratitude to all participants who consented to take part in this study.

Authors’ information

SS is a Consultant Physician [MBBS, MD, FRACP] Medical unit, Sri Jayawardenepura General Hospital. KPJ [MBBS], DKJ [MBBS] and DW [MBBS] are Registrars in Internal medicine, and SW is a Senior Registrar in Medicine at the Sri Jayawardenepura General Hospital.

No funding was obtained for this study.

Author information

Authors and affiliations.

Sri Jayewardenepura General Hospital, Kotte, Sri Lanka

K. P. Jayawickreme, D. K. Jayaweera, S. Weerasinghe, D. Warapitiya & S. Subasinghe

You can also search for this author in PubMed   Google Scholar

Contributions

Data collection was done by KPJ, DKJ and DW. Analysis, interpretation of data, literature review and writing of the report was done by KPJ. SS and SW guided the study and corrected the final manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to K. P. Jayawickreme .

Ethics declarations

Ethics approval and consent to participate.

Ethical clearance was taken from the institutional Ethical Review committee of the Sri Jayawardenepura General Hospital and Postgraduate Training Centre to conduct this study (SJGH/20/ERC/017). Informed written consent was taken from all the participants. All the participants were above the age of 13 years. In the very few participants aged between 13 and 16, informed written consent was obtained from both the participant and the parent or guardian.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: appendix s1..

Questionnaire in English.

Additional file 2: Appendix S2.

Questionnaire in Sinhala.

Additional file 3: Appendix S3.

Questionnaire in Tamil.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Jayawickreme, K.P., Jayaweera, D.K., Weerasinghe, S. et al. A study on knowledge, attitudes and practices regarding dengue fever, its prevention and management among dengue patients presenting to a tertiary care hospital in Sri Lanka. BMC Infect Dis 21 , 981 (2021). https://doi.org/10.1186/s12879-021-06685-5

Download citation

Received : 03 April 2020

Accepted : 13 September 2021

Published : 20 September 2021

DOI : https://doi.org/10.1186/s12879-021-06685-5

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Dengue fever

BMC Infectious Diseases

ISSN: 1471-2334

• General enquiries: [email protected]

Fact sheets

• Facts in pictures
• Publications
• Questions and answers
• Tools and toolkits
• HIV and AIDS
• Hypertension
• Mental disorders
• Top 10 causes of death
• All countries
• Eastern Mediterranean
• South-East Asia
• Western Pacific
• Data by country
• Country presence 
• Country strengthening 
• Country cooperation strategies 
• News releases

Feature stories

• Press conferences
• Commentaries
• Photo library
• Afghanistan
• Cholera 
• Coronavirus disease (COVID-19)
• Greater Horn of Africa
• Israel and occupied Palestinian territory
• Disease Outbreak News
• Situation reports
• Weekly Epidemiological Record
• Surveillance
• Health emergency appeal
• International Health Regulations
• Independent Oversight and Advisory Committee
• Classifications
• Data collections
• Global Health Estimates
• Mortality Database
• Sustainable Development Goals
• Health Inequality Monitor
• Global Progress
• Data collection tools
• Global Health Observatory
• Insights and visualizations
• COVID excess deaths
• World Health Statistics
• Partnerships
• Committees and advisory groups
• Collaborating centres
• Technical teams
• Organizational structure
• Initiatives
• General Programme of Work
• WHO Academy
• Investment case
• WHO Foundation
• External audit
• Financial statements
• Internal audit and investigations 
• Programme Budget
• Results reports
• Governing bodies
• World Health Assembly
• Executive Board
• Member States Portal
• Fact sheets /

Dengue and severe dengue

• Dengue is a viral infection transmitted to humans through the bite of infected mosquitoes.
• About half of the world's population is now at risk of dengue with an estimated 100–400 million infections occurring each year.
• Dengue is found in tropical and sub-tropical climates worldwide, mostly in urban and semi-urban areas.
• While many dengue infections are asymptomatic or produce only mild illness, the virus can occasionally cause more severe cases, and even death.
• Prevention and control of dengue depend on vector control. There is no specific treatment for dengue/severe dengue, and early detection and access to proper medical care greatly lower fatality rates of severe dengue.

Dengue (break-bone fever) is a viral infection that spreads from mosquitoes to people. It is more common in tropical and subtropical climates.

Most people who get dengue will not have symptoms. But for those who do, the most common symptoms are high fever, headache, body aches, nausea, and rash. Most will get better in 1–2 weeks. Some people develop severe dengue and need care in a hospital. 

In severe cases, dengue can be fatal.  

You can lower your risk of dengue by avoiding mosquito bites especially during the day.

Dengue is treated with pain medicine as there is no specific treatment currently.

Most people with dengue have mild or no symptoms and will get better in 1–2 weeks. Rarely, dengue can be severe and lead to death.  

If symptoms occur, they usually begin 4–10 days after infection and last for 2–7 days. Symptoms may include:

• high fever (40°C/104°F)
• severe headache
• pain behind the eyes
• muscle and joint pains
• swollen glands
• rash. 

Individuals who are infected for the second time are at greater risk of severe dengue.

Severe dengue symptoms often come after the fever has gone away:

• severe abdominal pain
• persistent vomiting
• rapid breathing
• bleeding gums or nose 
• restlessness
• blood in vomit or stool
• being very thirsty
• pale and cold skin
• feeling weak.

People with these severe symptoms should get care right away. 

After recovery, people who have had dengue may feel tired for several weeks.

Diagnostics and treatment

There is no specific treatment for dengue. The focus is on treating pain symptoms. Most cases of dengue fever can be treated at home with pain medicine.

Acetaminophen (paracetamol) is often used to control pain. Non-steroidal anti-inflammatory drugs like ibuprofen and aspirin are avoided as they can increase the risk of bleeding.

For people with severe dengue, hospitalization is often needed.

Global burden

The incidence of dengue has grown dramatically around the world in recent decades, with cases reported to WHO increasing from 505 430 cases in 2000 to 5.2 million in 2019. A vast majority of cases are asymptomatic or mild and self-managed, and hence the actual numbers of dengue cases are under-reported. Many cases are also misdiagnosed as other febrile illnesses  (1) . 

The highest number of dengue cases was recorded in 2023, affecting over 80 countries in all regions of WHO. Since the beginning of 2023 ongoing transmission, combined with an unexpected spike in dengue cases, resulted in a historic high of over 6.5 million cases and more than 7300 dengue-related deaths reported.

Several factors are associated with the increasing risk of spread of the dengue epidemic: the changing distribution of the vectors (chiefly  Aedes aegypti and Aedes albopictus mosquitoes), especially in previously dengue naïve countries; the consequences of El Niño phenomena in 2023 and climate change leading to increasing temperatures and high rainfall and humidity; fragile health systems in the midst of the COVID-19 pandemic; and political and financial instabilities in countries facing complex humanitarian crises and high population movements.

One modelling estimate indicates 390 million dengue virus infections per year of which 96 million manifest clinically  (2) . Another study on the prevalence of dengue estimates that 3.9 billion people are at risk of infection with dengue viruses (3).

The disease is now endemic in more than 100 countries in the WHO Regions of Africa, the Americas, the Eastern Mediterranean, South-East Asia and the Western Pacific. The Americas, South-East Asia and Western Pacific regions are the most seriously affected, with Asia representing around 70% of the global disease burden.

Dengue is spreading to new areas in Europe, the Eastern Mediterranean and South America.

The largest number of dengue cases reported was in 2023. The WHO Region of the Americas reported 4.5 million cases, with 2300 deaths. A high number of cases were reported in Asia: Bangladesh (321 000), Malaysia (111 400), Thailand (150 000), and Viet Nam (369 000).

Transmission

Transmission through the mosquito bite

The dengue virus is transmitted to humans through the bites of infected female mosquitoes, primarily the  Aedes aegypti  mosquito. Other species within the Aedes genus can also act as vectors, but their contribution is normally secondary to  Aedes aegypti . However, in 2023, a surge in local transmission of dengue by Aedes albopictus (tiger mosquito) has been seen in Europe.

After feeding on a infected person, the virus replicates in the mosquito midgut before disseminating to secondary tissues, including the salivary glands. The time it takes from ingesting the virus to actual transmission to a new host is termed the extrinsic incubation period (EIP). The EIP takes about 8–12 days when the ambient temperature is between 25–28°C. Variations in the extrinsic incubation period are not only influenced by ambient temperature; several factors such as the magnitude of daily temperature fluctuations, virus genotype, and initial viral concentration   can also alter the time it takes for a mosquito to transmit the virus. Once infectious, the  mosquito can transmit the virus for the rest of its life .

Human-to-mosquito transmission

Mosquitoes can become infected by people who are viremic with the dengue virus. This can be someone who has a symptomatic dengue infection, someone who is yet to have a symptomatic infection (they are pre-symptomatic), and also someone who shows no signs of illness (they are asymptomatic).

Human-to-mosquito transmission can occur up to 2 days before someone shows symptoms of the illness, and up to 2 days after the fever has resolved.

The risk of mosquito infection is positively associated with high viremia and high fever in the patient; conversely, high levels of DENV-specific antibodies are associated with a decreased risk of mosquito infection. Most people are viremic for about 4–5 days, but viremia can last as long as 12 days.

Maternal transmission

The primary mode of transmission of the dengue virus between humans involves mosquito vectors. There is evidence however, of the possibility of maternal transmission (from a pregnant mother to her baby). At the same time, vertical transmission rates appear low, with the risk of vertical transmission seemingly linked to the timing of the dengue infection during the pregnancy. When a mother does have a dengue infection when she is pregnant, babies may suffer from pre-term birth, low birthweight, and fetal distress.

Other transmission modes

Rare cases of transmission via blood products, organ donation and transfusions have been recorded. Similarly, transovarial transmission of the virus within mosquitoes have also been recorded. 

Risk factors

Previous infection with DENV increases the risk of the individual developing severe dengue.

Urbanization (especially unplanned), is associated with dengue transmission through multiple social and environmental factors: population density, human mobility, access to reliable water source, water storage practice etc.

Community risks to dengue also depend on a population’s knowledge, attitude and practice towards dengue, as the exposure is closely related to behaviours such as water storage, plant keeping, and self-protection against mosquito bites.  Routine vector surveillance and control activities engaging community greatly enhances a community’s resilience. 

Vectors might adapt to new environments and climate. The interaction between dengue virus, the host and the environment is dynamic. Consequently, disease risks may change and shift with climate change in tropical and subtropical areas, in combination with increased urbanization and movement of populations.

Prevention and control

The mosquitoes that spread dengue are active during the day. 

Lower the risk of getting dengue by protecting yourself from mosquito bites by using: 

• clothes that cover as much of your body as possible;
• mosquito nets if sleeping during the day, ideally nets sprayed with insect repellent;
• window screens;
• mosquito repellents (containing DEET, Picaridin or IR3535); and
• coils and vaporizers.

Mosquito breeding can be prevented by:

• preventing mosquitoes from accessing egg-laying habitats by environmental management and modification;
• disposing of solid waste properly and removing artificial man-made habitats that can hold water;
• covering, emptying and cleaning domestic water storage containers on a weekly basis;
• applying appropriate insecticides to outdoor water storage containers.

If you get dengue, it’s important to:

• drink plenty of liquids;
• use acetaminophen (paracetamol) for pain;
• avoid non-steroidal anti-inflammatory drugs, like ibuprofen and aspirin; and
• watch for severe symptoms and contact your doctor as soon as possible if you notice any.

So far one vaccine (QDenga) has been approved and licensed in some countries. However, it is recommended only for the age group of 6 to 16 years in high transmission settings. Several additional vaccines are under evaluation.

WHO response

WHO responds to dengue in the following ways:

• supports countries in the confirmation of outbreaks through its collaborating network of laboratories;
• provides technical support and guidance to countries for the effective management of dengue outbreaks;
• supports countries in improving their reporting systems and capture the true burden of the disease;
• provides training on clinical management, diagnosis and vector control at the country and regional level with some of its collaborating centres;
• formulates evidence-based strategies and policies;
• support countries in the development of dengue prevention and control strategies and adopting the Global Vector Control Response (2017–2030) and the Global Arbovirus Initiative (2022–2025).
• reviews and recommends the development of new tools, including insecticide products and application technologies;
• gathers official records of dengue and severe dengue from over 100 Member States; and
• publishes guidelines and handbooks for surveillance, case management, diagnosis, dengue prevention and control for Member States.
• Waggoner, J.J., et al., Viremia and Clinical Presentation in Nicaraguan Patients Infected Wi1. Waggoner, J.J., et al., Viremia and Clinical Presentation in Nicaraguan Patients Infected With Zika Virus, Chikungunya Virus, and Dengue Virus. Clinical Infectious Diseases, 2016. 63(12): p. 1584-1590.
• Bhatt, S., et al., The global distribution and burden of dengue.  Nature , 2013. 496(7446): p. 504–507.
• Brady, O.J., et al., Refining the global spatial limits of dengue virus transmission by evidence-based consensus.  PLOS Neglected Tropical Diseases , 2012. 6(8): p. e1760.

University of Nevada, Reno

•   ScholarWorks | University of Nevada, Reno
• Theses and Dissertations
• Electronic Theses and Dissertations

Dengue Fever: An Examination and Case Study

Ravikumar, Visesh 2016 Dengue Fever - An Examination and Case Study.pdf

View/ download.

Degree Level

Degree name.

Citations in Web of Science©

Permanent link

Additional information.

Collections

• Electronic Theses and Dissertations [6814]

Information

• Case Report
• Open access
• Published: 17 July 2023

Unforeseen complications: a case of dengue shock syndrome presenting with multi-organ dysfunction in a subtropical region

• Syed Muhammad Owais 1 ,
• Farrukh Ansar   ORCID: orcid.org/0000-0002-9056-5245 2 ,
• Muhammad Saqib   ORCID: orcid.org/0000-0003-3645-6416 3 ,
• Khatira Wahid 1 ,
• Khalid Rashid   ORCID: orcid.org/0000-0002-4771-6896 4 , 5 &
• Hassan Mumtaz   ORCID: orcid.org/0000-0003-2881-2556 6 , 7  

Tropical Medicine and Health volume  51 , Article number:  39 ( 2023 ) Cite this article

4141 Accesses

1 Citations

1 Altmetric

Metrics details

Dengue fever, a viral illness transmitted by the Aedes mosquito, is capable of causing a range of serious complications, including fulminant hepatic failure, renal dysfunction, encephalitis, encephalopathy, neuromuscular and ophthalmic disorders, seizures, and cardiomyopathy.

Case description

This report details the case of a 30-year-old lactating woman with no notable medical history who presented to the emergency department with symptoms of high-grade fever, altered mental status, and seizures. Upon imaging, bilateral infarcts in the thalami and cerebellar hemispheres were observed, consistent with cerebellitis and dengue encephalitis.

Patient treatment and outcome

The patient was admitted to the intensive care unit and received appropriate treatment. Following a critical phase and successful patient stabilization, she was transferred to a high dependency unit for a week before being discharged with recommendations for follow-up care.

This case illustrates the broad spectrum of complications that can arise as a result of dengue infection and the importance of timely diagnosis and management in improving patient outcomes. Further investigation is required to better understand the mechanisms underlying these complications and to formulate specific guidelines for the prevention and treatment of dengue shock syndrome.

Introduction

Dengue fever is a viral infection transmitted by the Aedes mosquito. It is caused by one of four serotypes of the dengue virus (DENV 1–4). The dengue virus belongs to the Flaviviridae family of ribonucleic acid (RNA) viruses [ 1 ]. Dengue is an endemic disease in tropical and subtropical countries, putting almost four billion people worldwide at risk. The prevalence of dengue has rapidly increased in the Southeast Asian region in recent years. It is important for people living in or traveling to areas where dengue is prevalent to take precautions to protect themselves from mosquito bites and to seek medical attention if they develop symptoms of dengue fever [ 2 ]. Dengue shock syndrome (DSS) is the most severe manifestation of dengue infection and can have a mortality rate of up to 20% if not treated appropriately. DSS is characterized by a rapid drop in blood pressure, leading to shock and organ failure. Early diagnosis and management of DSS is crucial for improving patient outcomes. It is important for healthcare providers to be aware of the signs and symptoms of DSS and to initiate prompt treatment in order to prevent complications and reduce mortality [ 1 ]. It has been suggested that there are over 350 million reported cases of dengue and 22,000 related deaths worldwide each year [ 3 ]. Generally, dengue infection is characterized by a high-grade fever accompanied by rigors, chills, body aches, and a transient macular rash. However, in rare cases, complicated dengue infection can lead to severe complications such as fulminant hepatic failure, renal dysfunction, encephalitis, encephalopathy, neuromuscular and ophthalmic disorders, seizures, and cardiomyopathy [ 4 ]. Severe hepatic involvement associated with dengue infection is very rare. According to a large retrospective cohort study from the Hospital for Tropical Disease in Thailand, the incidence of acute liver failure in symptomatic dengue patients was less than 0.5%, but it had a significant mortality rate of 66%. This highlights the importance of early diagnosis and management of dengue infection in order to prevent complications and reduce mortality [ 5 ].

Case presentation

A 30-year-old lactating mother in subtropical South Asia with no significant past medical or surgical history presented to the emergency room with chief complaints of high-grade fever, altered mental status, and seizure. High grade and intermittent fever had been present since five days prior to admission, accompanied by rigors and chills. The patient’s mental status altered gradually starting with a loss of orientation and progressing to complete obtundation. The patient also experienced abrupt localized seizure in her lower limbs every half to one hour, without generalized tonic–clonic seizures or tongue bites. The patient did not have any bowel or bladder incontinence.

Physical examination revealed body temperature of 101 ºF, blood pressure of 99/64 mmHg, pulse of 144/min, oxygen saturation of 94% on room air, a respiratory rate of 36/min and a Glasgow Coma Scale score of 5/15 with a fixed constricted pupil. A malar rash on the face, palmar erythema, left lower extremity focal seizures, prolonged capillary refill, cold, clammy, and mottled skin were observed. The rest of the physical examination was unremarkable. The patient's random blood glucose was 180 mg/dl, and there were no signs of meningismus. Blood test revealed a hemoglobin level of 12.7 g/dL, a platelet count of 105 × 10 9 /L, and neutrophils of 27.5 × 10 9 /L. The alanine transaminase was 1394 U/L, C-reactive protein was 19.2 mg/dL, creatinine was 1.79 mg/dL, activated partial thromboplastin time was 61.7 s, procalcitonin was 0.00835 mg/dl, and Troponin I was raised at 0.00012168 mg/dl.

An echocardiography report showed an ejection fraction of 35–39% with mild pulmonary hypertension and moderate left ventricular systolic dysfunction. A brain computed tomography (CT) scan showed hypodensity in both the thalami and cerebellar hemispheres, suggesting bilateral thalamic and cerebellar infarcts and a possibility of cerebellitis and encephalitis. Grey–white matter differentiation appeared intact, and there was no evidence of a focal mass, midline shift, or hematoma. A brain magnetic resonance imaging (MRI) showed bilateral, almost symmetrical, high signals on T2-weighted and fluid-attenuated inversion recovery images in the thalami cerebellar hemispheres and bilateral cerebral cortices, which indicated the possibility of encephalitis or postictal ischemic changes. An enhanced CT scan of the chest and abdomen showed bilateral basal atelectasis, hepatomegaly, a distended gallbladder and enlarged bilateral iliacus muscles with internal hyperdense and hypodense areas suggesting the possibility of bilateral iliacus hematomas with some liquefaction.

The patient was diagnosed as sepsis, metabolic acidosis (evident from serum bicarbonate levels of 18 mEq/L, arterial pCO2 of 29 mmHg and a pH of 7.23), respiratory distress, acute kidney injury, heart failure due to myocarditis, acute liver injury and possible brain edema. Sudden onset of high-grade fever, systemic symptoms with multiple organ failure and local endemic situation arose the possibility of dengue shock syndrome although normal platelet count and absence of petechial rashes on the body were not compatible.

Further investigation revealed positive dengue non-specific antigen 1 (Dengue NS1 Ag) and positive dengue immunoglobulin M antibody (Dengue IgM Ab)done using qualitative Wondfo© One Step Dengue NS1 Antigen kits. A graphical summary of the case as well as the table of investigations can be seen in Fig.  1 .

Summary of the case ( a ) and table of investigations ( b ). *Only the deranged values have been reported; Dengue NS1 Ag: dengue non-specific antigen 1; Dengue IgM Ab: dengue immunoglobulin M antibody

The patient was admitted to the intensive care unit and intravenous fluids were started (3% normal saline, 100 ml/h) with 0.10 μg/kg/min of norepinephrine. Mechanical ventilation was initiated due to the patient's deteriorating respiratory status, suspected secondary bacterial infection and herpes encephalitis, intravenous antibiotics (ceftriaxone 1 g/12 h and azithromycin 500 mg/day) and acyclovir (400 mg/8 h). In addition, the patient received intravenous insulin (0.1 units/kg/h) to maintain normal blood sugar levels and intravenous vasopressin (0.01 units/min) to maintain optimal blood pressure (above 120 mmHg systolic and above 80 mmHg diastolic) on the first day of admission. The patient soon started responding to treatment with gradual improvement in consciousness and laboratory findings.

The patient's renal function was monitored closely, and hemodialysis was initiated on the first day of admission. The patient's liver function was also monitored, and she received intravenous N -acetylcysteine and a low-fat diet. N-acetylcysteine (NAC) was administered in a specific dosing regimen. Initially, a bolus dose of 150 mg/kg body weight was administered, followed by a maintenance dosage of 12.5 mg/kg/h over a duration of 4 h. Subsequently, the maintenance dosage was adjusted to 6.25 mg/kg/h and continued for up to 72 h.

The patient's condition improved gradually over the next few days, and the mechanical ventilation was discontinued on the fourth day of admission. The patient was transferred to the high dependency unit for further management and stayed there for a week. After satisfactory echocardiography (revealing ejection fraction of 59% with a cardiac output 6.0 L per minute and a heart rate of 80 beats per minute, indicating a normal cardiac profile) and CT scan results (resolution of thalamic and cerebellar involvement seen on previous CT scans), the patient was discharged and advised to follow-up. CT scan and MRI images taken before recovery are shown in Figs.  2 and  3 , respectively. CT scan of the brain, revealed bilateral thalamic and cerebellar infarcts, suggesting brain involvement. Additionally, a magnetic resonance imaging (MRI) of the brain showed abnormal signals in the thalami, cerebellar hemispheres, and bilateral cerebral cortices, indicating the presence of dengue encephalitis or postictal ischemic changes. These imaging findings support the diagnosis of neurological involvement in the patient.

CT scan showing bilateral thalamic and cerebellar hypodensities ( a , b ); patient details are hidden to protect patient privacy

MRI scan showing bilateral thalamic and cerebellar infarcts ( a – c ); patient details are hidden to protect patient privacy

The patient was conscious towards the end of day 1 and slowly improved function. There was a mild residual muscle weakness in the proximal thigh muscles which improved in the subsequent days. This could be due to the lower limb seizures that were observed in the initial phase of admission. There were no signs of muscle paralysis observed in the patient. A recovery CT scan done on day 4 showed resolution of brain findings seen on CT previously as shown in Fig.  4 .

CT scan of the brain after recovery showing resolution of all findings seen on previous CT scan; patient details are hidden to protect patient privacy

The relationship between dengue fever and neurological manifestations was first described in 1976, and multiple studies since then have shown that dengue fever can be associated with neurological complications [ 6 , 7 ]. Neurological manifestations of dengue fever can include headaches, irritability, alteration of consciousness, insomnia, and focal neurological deficits. These manifestations may be associated with encephalitis and seizures [ 6 ]. Dengue fever presents various neurological manifestations that can be classified into three distinct categories. The first category involves direct neurotropism, leading to conditions such as encephalitis, meningitis, myelitis, and myositis. The second category encompasses systemic complications, which include encephalopathy, stroke, and hypokalemic paralysis. Lastly, there are post-infectious or immune-mediated manifestations, such as acute disseminated encephalomyelitis (ADEM), Guillain–Barré syndrome (GBS), and optic neuritis [ 8 ].

In our case, the patient belonged to a subtropical region of South Asia and presented with altered mental status, seizure, and low Glasgow Coma Scale score, which were indicative of neurological involvement. This was supported by a CT scan showing bilateral thalamic and cerebellar infarcts due to possible brain edema, possibly indicating cerebellitis and dengue encephalitis. Myocarditis and cardiac dysfunction are rare but recognized complications of dengue fever. Earlier studies have reported on these complications, but did not specify which serotype was most commonly associated with them. More recent studies, however, have suggested that dengue virus serotype 2 (DENV-2) may be particularly implicated in causing myocardial dysfunction in children. Cardiac complications of dengue fever tend to manifest early in the disease course, and common electrocardiographic changes include T-wave inversion. These findings have been described in the literature previously [ 9 ]. In the current case, our patient was suspected to have myocarditis, which was later confirmed by the presence of a raised Troponin I level and a low ejection fraction on echocardiography. Acute kidney injury (AKI) is a significant complication that can occur in patients with dengue fever, particularly in those who are hospitalized for extended periods of time. The etiology of AKI in dengue fever is not fully understood, but proposed mechanisms include rhabdomyolysis, hemodynamic instability, acute glomerular injury, and hemolysis, all of which can lead to tubular necrosis, thrombotic microangiopathy, and acute glomerulopathy. Unfortunately, patients with dengue fever who develop renal complications such as AKI have a higher mortality rate. There are currently no specific recommendations for the treatment of AKI in dengue patients, and treatment typically involves conventional renal replacement therapy [ 10 ]. Dengue fever can affect the liver, which is the most commonly affected organ in patients with this infection. Liver involvement can range from mild elevation of hepatic transaminases to severe acute liver failure. The mechanisms behind liver injury in dengue fever are not fully understood, but may include hypoxic liver injury due to shock, direct virological attack on hepatocytes, and immunological damage to the liver. The management of acute liver injury in dengue fever can be challenging, as there are few guidelines available on the best approach. In the past, some studies have suggested that the use of NAC as an antidote for acetaminophen toxicity may be beneficial in the management of acute liver failure in dengue fever, as it has been associated with reduced mortality and high transplant-free survival, particularly when used in the early stages of the disease [ 11 ]. In our case, the administration of NAC was based on evidence from a recent meta-analysis conducted by Walayat et al. [ 12 ], which highlighted the significant improvement in overall survival associated with NAC, even in cases of non-acetaminophen-related acute liver failure [ 12 ]. The underlying pathophysiology of dengue fever involves a complex interplay between the virus and host-specific factors. The dengue virus replicates inside host cells, triggering the release of immune-mediated destruction and cytokines. While there is increased vascular permeability, plasma leakage is typically confined to the pleural and peritoneal cavities and does not result in generalized edema. The development of hemorrhagic diathesis is thought to be caused by liver damage that leads to decreased secretion of coagulative factors and albumin. The virus also replicates in the adrenal gland, contributing to sodium loss and hypotension. The presence of petechiae, which are small red or purple spots on the skin, is likely due to capillary fragility, thrombocytopenia, and cytokines that disrupt vascular integrity [ 13 , 14 ]. In dengue infection, both thrombosis and brain edema are potential mechanisms underlying the vascular involvement observed in cerebellitis and dengue encephalitis. Thrombosis can occur due to endothelial dysfunction and increased vascular permeability, leading to impaired blood flow and infarction in cerebral blood vessels. Meanwhile, the inflammatory response triggered by dengue fever can cause brain edema through the release of cytokines and immune mediators, resulting in increased blood–brain barrier permeability and fluid accumulation in the brain tissue. Brain edema can subsequently compress surrounding vessels and compromise blood flow, potentially leading to ischemic events and infarction [ 15 ]. It is evident from the CT images that the patient in our case most probably had ischemic changes due to brain edema that resolved in the subsequent days as evident in follow-up recovery brain CT scan which shows no residual findings.

Our patient presented to the emergency department with encephalopathy leading to coma, a neurological complication of dengue fever. There is a difference between encephalopathy and encephalitis in dengue virus infection which can be seen in Table 1 .

Upon examination, the patient was found to be in shock, as indicated by tachycardia, tachypnea, hypotension, cold, clammy, and mottled skin, and prolonged capillary refill. The presence of palmar erythema and malar rash may have been due to the physiological effects of pregnancy. Initially, the absence of petechiae and a good platelet count led us to suspect a case of non-dengue viral sepsis. However, dengue antigenic testing eventually revealed a positive result. This case is unique in that it involved multiple organ involvement mimicking viral sepsis, but without evidence of petechiae and a relatively good platelet count given the patient's condition. The diagnosis of dengue infection was ultimately reached through extensive testing and an astute clinical approach.

The patient was suffering from acute liver injury, acute kidney injury (AKI), heart failure (myocarditis), hypernatremia, and possible brain edema. While previous reports have described similar complications of dengue fever, this case is unusual in that it involved all of these complications simultaneously [ 16 , 17 , 18 ]. Our treatment regimen was in accordance with the guidelines provided by the Centers for Disease Control and Prevention [ 19 ]. Our treatment approach was also informed by based on the findings of multiple randomized controlled trials studied by Kalayanarooj et al. [ 20 ]. In the management of our patient, we focused on restoring and maintaining intravascular volume for sufficient end-organ perfusion. To this end, we administered intravenous fluids and norepinephrine to improve hemodynamics and normalize blood pressure, as well as antibiotics to control sepsis. We did not use beta blockers to lower the patient's heart rate, but closely monitored it instead. Other treatments included oral proton pump inhibitors to prevent stress ulcers, whole-nutrition in the form of Ensure®, compression stockings to prevent deep vein thrombosis, and any other necessary medications. There are many reasons why our case is unique. First, the case presents a unique and rare combination of serious complications of dengue fever, including dengue encephalitis, suspected myocarditis, acute kidney injury, and acute liver failure. This is an unusual presentation of dengue fever that has not been widely reported in the literature and would be of interest to healthcare professionals and researchers studying this disease. Second, the case report provides a detailed account of the patient's clinical presentation, diagnostic workup, and management, including the specific treatment strategies employed to address each of the complications. This information would be valuable to other healthcare professionals caring for patients with dengue fever and could inform future clinical practice. Finally, the successful management of the patient's multiple serious complications and the patient's eventual recovery make this an informative and inspiring case report that would be of interest to a wide audience. More interdisciplinary and evidence-based studies are required to make guidelines and decide on diagnosis and optimum fluid management in dengue infections complicated by encephalopathy in lactating women with dengue infection complicated by multiple complications. The guidelines are essential to facilitate management and prevent any adverse outcomes.

CARE checklist

In conclusion, dengue fever presented in our case with a wide range of complications involving various organs, such as the brain, kidneys, liver, and myocardium. These complications ranged from encephalitis and seizures to acute kidney injury and myocarditis. It is important for healthcare professionals to be aware of the potential complications of dengue fever and to promptly diagnose and manage them in order to improve patient outcomes.

Patient’s own perspective

The patient reported “As a young, healthy mother, I never expected to wind up in the intensive care unit struggling for my life. But that's exactly what happened when I contracted dengue fever. It all started with a high fever came on suddenly. I figured I had just caught a bug and would be feeling better soon, but my condition only seemed to get worse. Before long, I was experiencing changes in my mental status. When I arrived at the hospital, I was rushed to the emergency department for evaluation. The doctors told me that I had dengue fever and that it had caused complications, including brain inflammation. They immediately started me on treatment and transferred me to the intensive care unit. The next few days were a blur. I remember being hooked up to a lot of machines and feeling very weak and tired. My family was by my side, and the doctors and nurses were all very kind and compassionate, but I was in a lot of pain and was barely able to communicate. Eventually, I started to improve. I was transferred to a high dependency unit and was able to receive more targeted care. After a week, I was finally stable enough to be discharged from the hospital. Looking back, I am grateful to have survived this terrifying experience. But I also hope that others can learn from my story and take the necessary precautions to protect themselves from dengue fever. If you're traveling to an area where dengue is prevalent, be sure to use insect repellent and take other precautions to avoid mosquito bites. And if you do start to feel sick, don't wait to seek medical attention. Early diagnosis and treatment can make all the difference.”

Availability of data and materials

The data collected and analyzed during this case report are available upon request, subject to ethical and legal considerations. All data will be de-identified to protect the privacy of the patient.

Khetarpal N, Khanna I. Dengue fever: causes, complications, and vaccine strategies. J Immunol Res. 2016;2016:6803098. https://doi.org/10.1155/2016/6803098 . ( Epub 2016/08/16 ).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Brady OJ, Gething PW, Bhatt S, Messina JP, Brownstein JS, Hoen AG, et al. Refining the global spatial limits of dengue virus transmission by evidence-based consensus. PLoS Negl Tropic Dis. 2012;6(8):e1760. https://doi.org/10.1371/journal.pntd.0001760 . ( Epub 2012/08/11 ).

Article   Google Scholar  

Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013;496(7446):504–7. https://doi.org/10.1038/nature12060 . ( Epub 2013/04/09 ).

Carod-Artal FJ, Wichmann O, Farrar J, Gascón J. Neurological complications of dengue virus infection. Lancet Neurol. 2013;12(9):906–19. https://doi.org/10.1016/s1474-4422(13)70150-9 . ( Epub 2013/08/21 ).

Article   PubMed   Google Scholar  

Kye Mon K, Nontprasert A, Kittitrakul C, Tangkijvanich P, Leowattana W, Poovorawan K. Incidence and clinical outcome of acute liver failure caused by dengue in a hospital for tropical diseases, Thailand. Am J Trop Med Hygiene. 2016;95(6):1338–44. https://doi.org/10.4269/ajtmh.16-0374 . ( Epub 2016/12/09 ).

Peter S, Malhotra N, Peter P, Sood R. Isolated Bell’s palsy - an unusual presentation of dengue infection. Asian Pac J Trop Med. 2013;6(1):82–4. https://doi.org/10.1016/s1995-7645(12)60207-7 . ( Epub 2013/01/16 ).

Article   CAS   PubMed   Google Scholar  

Solomon T, Dung NM, Vaughn DW, Kneen R, Thao LT, Raengsakulrach B, et al. Neurological manifestations of dengue infection. Lancet. 2000;355(9209):1053–9. https://doi.org/10.1016/s0140-6736(00)02036-5 . ( Epub 2000/04/01 ).

Kulkarni R, Pujari S, Gupta D. Neurological manifestations of dengue fever. Ann Indian Acad Neurol. 2021;24(5):693–702. https://doi.org/10.4103/aian.AIAN_157_21 .

Article   PubMed   PubMed Central   Google Scholar  

Kularatne SA, Pathirage MM, Medagama UA, Gunasena S, Gunasekara MB. Myocarditis in three patients with dengue virus type DEN 3 infection. Ceylon Med J. 2006;51(2):75–6. https://doi.org/10.4038/cmj.v51i2.1362 . ( Epub 2006/12/22 ).

Oliveira JF, Burdmann EA. Dengue-associated acute kidney injury. Clin Kidney J. 2015;8(6):681–5. https://doi.org/10.1093/ckj/sfv106 . ( Epub 2015/11/28 ).

Suganthan N, Sakthilingham G, Kumanan T. Dengue fever complicated with acute liver failure: a case report of expanded dengue syndrome and literature review. SAGE Open Med Case Rep. 2020. https://doi.org/10.1177/2050313x20913428 .

Walayat S, Shoaib H, Asghar M, Kim M, Dhillon S. Role of N-acetylcysteine in non-acetaminophen-related acute liver failure: an updated meta-analysis and systematic review. Ann Gastroenterol. 2021;34(2):235–40. https://doi.org/10.20524/aog.2021.0571 .

Martina BE, Koraka P, Osterhaus AD. Dengue virus pathogenesis: an integrated view. Clin Microbiol Rev. 2009;22(4):564–81. https://doi.org/10.1128/cmr.00035-09 . ( Epub 2009/10/14 ).

Sellahewa KH. Pathogenesis of dengue haemorrhagic fever and its impact on case management. ISRN Infect Dis. 2013;2013:571646. https://doi.org/10.5402/2013/571646 .

Adane T, Getawa S. Coagulation abnormalities in Dengue fever infection: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2021;15(8):e0009666. https://doi.org/10.1371/journal.pntd.0009666 .

Arora S, Nathaniel SD, Paul JC, Hansdak SG. Acute liver failure in dengue haemorrhagic fever. BMJ Case Rep. 2015. https://doi.org/10.1136/bcr-2015-209443 . ( Epub 2015/05/27 ).

Lee I-K, Lee W-H, Liu J-W, Yang KD. Acute myocarditis in dengue hemorrhagic fever: a case report and review of cardiac complications in dengue-affected patients. Int J Infect Dis. 2010;14(10):e919–22. https://doi.org/10.1016/j.ijid.2010.06.011 .

Vachvanichsanong P, Thisyakorn U, Thisyakorn C. Dengue hemorrhagic fever and the kidney. Arch Virol. 2016;161(4):771–8. https://doi.org/10.1007/s00705-015-2727-1 . ( Epub 2015/12/25 ).

Dengue clinician guide. Centers for Disease Control and Prevention; 2023. https://www.cdc.gov/dengue/resources/dengue-clinician-guide_508.pdf . Accessed 8 Jan 2023.

Kalayanarooj S, Rothman AL, Srikiatkhachorn A. Case management of dengue: lessons learned. J Infect Dis. 2017;215(suppl_2):S79–88. https://doi.org/10.1093/infdis/jiw609 .

Hendarto SK, Hadinegoro SR. Dengue encephalopathy. Acta Paediatr Jpn. 1992;34(3):350–7. https://doi.org/10.1111/j.1442-200x.1992.tb00971.x .

Borawake K, Prayag P, Wagh A, Dole S. Dengue encephalitis. Indian J Crit Care Med. 2011;15(3):190–3. https://doi.org/10.4103/0972-5229.84896 .

Angibaud G, Luaute J, Laille M, Gaultier C. Brain involvement in Dengue fever. J Clin Neurosci. 2001;8(1):63–5. https://doi.org/10.1054/jocn.2000.0735 .

Download references

Acknowledgements

Author information, authors and affiliations.

Northwest General Hospital & Research Centre, Peshawar, Pakistan

Syed Muhammad Owais & Khatira Wahid

Quaid e Azam International Hospital, Rawalpindi, Pakistan

Farrukh Ansar

Khyber Medical College, Peshawar, Pakistan

Muhammad Saqib

James Cook University Hospital, Middlesbrough, UK

Khalid Rashid

University of Sunderland, Sunderland, England, UK

Maroof International Hospital, Islamabad, Pakistan

Hassan Mumtaz

Health Services Academy, Islamabad, Pakistan

You can also search for this author in PubMed   Google Scholar

Contributions

SMO, FA and MS were lead authors and wrote the majority of the paper. FA conceived the study and contributed significantly to the design and planning of the study as well. MS was involved in the data collection and analysis, and contributed to the interpretation of the results as well. SMO, KR, KW and HM provided critical review and feedback on the manuscript. All authors contributed to the writing and editing of the final manuscript and approved the submitted version.

Corresponding author

Correspondence to Muhammad Saqib .

Ethics declarations

Ethics approval and consent to participate.

The care of patient described in this case report was conducted in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained from the patient before any clinical procedures were performed. All personal and identifying information has been de-identified to protect the privacy of the patient. A CARE checklist is provided in Fig.  5 .

Consent for publication

Informed consent was obtained for publication.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Owais, S.M., Ansar, F., Saqib, M. et al. Unforeseen complications: a case of dengue shock syndrome presenting with multi-organ dysfunction in a subtropical region. Trop Med Health 51 , 39 (2023). https://doi.org/10.1186/s41182-023-00530-y

Download citation

Received : 08 May 2023

Accepted : 11 July 2023

Published : 17 July 2023

DOI : https://doi.org/10.1186/s41182-023-00530-y

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Severe dengue
• Tropical climates
• Breast feeding
• Postpartum sepsis
• Neurological manifestations
• Myocarditis
• Acute renal failure
• Acute liver failure
• Case reports

Tropical Medicine and Health

ISSN: 1349-4147

• Submission enquiries: Access here and click Contact Us
• General enquiries: [email protected]

This page has been archived and is no longer updated

Current Dengue Fever Research

Introduction, basic research on dengue.

What does basic dengue research involve? Basic research includes a wide range of studies focused on learning how the dengue virus is transmitted and how it infects cells and causes disease. This type of research investigates many aspects of dengue viral biology, including exploration of the interactions between the virus and humans and studies of how the dengue virus replicates itself.

One important field of basic research is dengue pathogenesis , the study of the process and mechanisms of dengue in humans. Scientists want to understand how the dengue virus causes damage to the human body and how the immune system responds to a dengue infection so that they can develop new treatments for the disease. For example, researchers want to understand why bleeding and vascular leakage occur in patients with severe dengue illnesses. Knowledge of the disease pathway may help doctors and clinicians diagnose dengue at earlier stages. Researchers want to find out whether there are genetic factors that result in an increased or decreased risk of infection for individuals. Some people may be genetically susceptible to develop more severe symptoms than other people.

Scientists are also studying the dengue viruses to understand which factors are responsible for transmitting the virus to humans. Researchers are investigating how the dengue virus replicates itself and the structure of the viral components, such as the capsid, membrane, and envelope proteins. Scientists also want to know — how do the dengue viruses manage to avoid detection by the immune system? Because viruses can evolve and gain mutations over time, researchers are examining dengue viral genetics and evolution to investigate changes in viral genomes over time. These variations may help the virus hide from the immune system. Scientists know that particular viral sequences are associated with more severe dengue symptoms. In addition, certain dengue sequence variations may produce more deadly viruses with a greater potential for causing epidemics. This kind of information can help scientists monitor the regional spread of particularly dangerous dengue strains to help communities prevent or prepare for dengue outbreaks.

Other dengue research focuses on vector biology. What is vector biology? This field of dengue research studies the disease vector, Aedes mosquitoes. Vector biology studies mosquito ecology, population biology, genetics, and behaviors to understand how mosquitoes transmit the dengue viruses. Researchers can also study dengue transmission patterns. As one example, researchers studied dengue infections in children living in Nicaragua and saw that patterns of dengue transmission depended on changes in climate and changes in the dengue serotypes in the area. Large-scale studies of patterns in dengue transmission can provide essential information to resist the disease, identify and diagnose dengue cases, and implement mosquito-control efforts.

Diagnostics

Patients with severe dengue illnesses can be treated successfully if they are diagnosed as early as possible. Scientists are working on improving dengue diagnostics so that patients infected with dengue can be treated quickly. What would the ideal diagnostic test for dengue do? The ideal diagnostic test would be able to distinguish dengue from other diseases with similar symptoms and distinguish one dengue serotype from another. An ideal diagnostic test would be highly sensitive during the acute stage of the infection, quick and easy to use, and affordable.

How is dengue diagnosed? A number of laboratory methods are used to diagnose dengue, including detection of the dengue virus, viral RNA, viral antigens, and antibodies against the virus in the patient's blood or tissues (Figure 1). The virus can be detected in the blood for only four to five days after the onset of symptoms. During this early stage of the disease, isolation of the virus, viral RNA, and viral protein can be used to diagnose dengue.

The detection of antibodies (IgM and IgG) in the blood of an infected individual is an indirect method to diagnose dengue. This method is commonly used to diagnose dengue in the later stage of the disease, after the viral levels have decreased. Antibodies against dengue can be detected in most patients five days after the onset of symptoms, and IgG can be detected for many months and even years after an infection (Figure 2). During a primary (first) dengue infection, IgM levels are very high, but during a secondary infection, IgM levels are lower. The levels of IgG actually increase during a secondary infection. Therefore, clinicians can measure the amounts of IgM and IgG to decide whether a patient has a primary or a secondary dengue infection. This test can be useful because patients with secondary infections are more likely to have severe dengue than those who have not had a previous infection. Because dengue can be mistaken for other diseases such as yellow fever, measles, and influenza, it is best to confirm a diagnosis of dengue by detecting the antibody response and testing for direct evidence of the virus.

Have researchers developed any new diagnostic tests to diagnose dengue? Recently, scientists developed a rapid, one-step test to detect and distinguish all four dengue serotypes. This test is based on reverse transcription polymerase chain reaction amplification of the viral RNA, and it is a sensitive, rapid, and cost-effective tool to diagnose patients with dengue. A second approach involves diagnosing dengue infections by detecting NS1, one of the seven nonstructural dengue proteins. NS1 is produced in large quantities during dengue viral replication, and it can be detected as early as the first day the patient experiences a fever.

Is there a way to know which patients might develop severe dengue? Scientists want to find ways to quickly identify patients who are the most likely to develop severe dengue illnesses. To identify these patients, researchers must first discover predictive factors for severe dengue. One way researchers can discover these factors is to monitor the progression of the disease and look for factors that predict severe illness by taking frequent blood samples and ultrasound images from patients with dengue. Ultrasound can measure indicators of severe dengue, including the thickening of the gall bladder wall and excess fluids around the tissues and organs in the abdomen and chest cavity. Knowledge of additional predictive factors could help researchers design more effective diagnostic tests. Another strategy involves applying decision-making computer models to diagnose patients with dengue and predict their prognoses by using clinical data, such as the patient's platelet count and the presence of preexisting IgG antibodies against dengue in the blood.

Dengue Surveillance

What can other fields of research do to prevent and control dengue? In addition to performing basic research and improving diagnostics, improving dengue surveillance is an essential way to prevent and control dengue transmission. The World Health Organization — in partnership with ministries of health, research centers, and laboratories around the world — has developed a dengue surveillance system called DengueNet, a database that can be continuously updated to share current and historical data on dengue cases. The goals of DengueNet are to standardize reporting of dengue cases and to improve the preparedness of public health officials by providing early warnings prior to epidemics, which can help reduce fatality rates.

Monitoring mosquito populations is a first line of defense against dengue. Vector surveillance allows for a prompt response to control mosquito populations and limit dengue transmission. Studying vector competence, the ability of Aedes mosquitoes to acquire and transmit the dengue virus, can provide important information about variations in the transmission of the different dengue serotypes. Researchers have shown that delayed mosquito-control responses can lead to an exponential increase in both the number of infected people and health costs. Public health officials can prevent large dengue outbreaks by using surveillance information to plan mosquito-control efforts and interventions and to provide resources to affected areas. Vector surveillance is crucial for public health officials so that they can provide a prompt and preventative response to dengue.

Balmaseda, A. et al . Trends in patterns of dengue transmission over 4 years in a pediatric cohort study in Nicaragua. Journal of Infectious Diseases 201 , 5–14 (2010). doi:10.1086/648592

Deubel, V. "The Contribution of Molecular Techniques to the Diagnosis of Dengue Infections." In Dengue and Dengue Hemorrhagic Fever , eds. D. J. Gubler & G. Kuno (Cambridge: CABI, 2001): 335–365.

Guzman, M. G. et al . Dengue: A continuing global threat. Nature Reviews Microbiol ogy 8 , S7–S16 (2010). doi:10.1038/nrmicro2460

National Institute of Allergy and Infectious Diseases. " NIAID's Role in Dengue Fever Research " (2011).

———. " Predicting Who Will Get Sickest from Dengue Virus " (2009).

Peeling, R. W. et al . Evaluation of diagnostic tests: Dengue. Nature Reviews Microbiol ogy 8 , S30–S37 (2010). doi:10.1038/nrmicro2459

Priyadarshini, S. Single test to detect all dengue serotypes. Nature India (2008). doi:10.1038/nindia.2008.109

Saxena, P. et al . Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses. Virology Journal 5 , 20 (2008). doi:10.1186/1743-422X-5-20

Simmons, C. P. et al . "Understanding Pathogenesis, Immune Response and Viral Factors." In Report of the Scientific Working Group Meeting on Dengue, Geneva, 1 – 5 October, 2006. Geneva: World Health Organization, 2007: 54–60.

Tanner, L. et al . Decision tree algorithms predict the diagnosis and outcome of dengue fever in the early phase of illness. PLoS Neglected Tropical Diseases 2 , e196 (2008). doi:10.1371/journal.pntd.0000196

Vazquez-Prokopec, G. M. et al . Quantifying the spatial dimension of dengue virus epidemic spread within a tropical urban environment. PLoS Neglected Tropical Diseases 4 , e920 (2010). doi:10.1371/journal.pntd.0000920

Vazquez-Prokopec, G. M. et al . Unforeseen costs of cutting mosquito surveillance budgets. PLoS Neglected Tropical Diseases 4 , e858 (2010). doi:10.1371/journal.pntd.0000858

Vorndam, V. & Kuno, G. "Laboratory Diagnosis of Dengue Virus Infections." In Dengue and Dengue Hemorrhagic Fever , eds. D. J. Gubler & G. Kuno (Cambridge: CABI, 2001): 313–333.

World Health Organization. Dengue: Guidelines for Diagnosis, Treatment, Prevention and Control. Geneva: World Health Organization and the Special Programme for Research and Training in Tropical Diseases, 2009.

———. " DengueNet Database and Geographic Information System ." (2011).

Topic rooms within Cell Biology

Within this Subject (25)

• Basic (25)

Other Topic Rooms

• Gene Inheritance and Transmission
• Gene Expression and Regulation
• Nucleic Acid Structure and Function
• Chromosomes and Cytogenetics
• Evolutionary Genetics
• Population and Quantitative Genetics
• Genes and Disease
• Genetics and Society
• Cell Origins and Metabolism
• Proteins and Gene Expression
• Subcellular Compartments
• Cell Communication
• Cell Cycle and Cell Division

© 2014 Nature Education

• Press Room |
• Terms of Use |
• Privacy Notice |

Visual Browse

Loading metrics

Open Access

Peer-reviewed

Research Article

A systematic review of dengue outbreak prediction models: Current scenario and future directions

Roles Data curation, Project administration, Writing – original draft, Writing – review & editing

Affiliation School of Public Health and Preventive Medicine, Monash University, Melbourne, Victoria, Australia

Roles Data curation, Project administration, Writing – review & editing

Roles Conceptualization, Supervision, Writing – review & editing

Roles Data curation, Project administration, Visualization, Writing – review & editing

Roles Supervision, Visualization, Writing – review & editing

Roles Conceptualization, Writing – original draft, Writing – review & editing

Affiliation Department of Virology, Bangabandhu Sheikh Mujib Medical University, Dhaka, Bangladesh

Roles Conceptualization, Formal analysis, Methodology, Writing – original draft, Writing – review & editing

* E-mail: [email protected]

• Xing Yu Leung, 
• Rakibul M. Islam, 
• Mohammadmehdi Adhami, 
• Dragan Ilic, 
• Lara McDonald, 
• Shanika Palawaththa, 
• Basia Diug, 
• Saif U. Munshi, 
• Md Nazmul Karim

• Published: February 13, 2023
• https://doi.org/10.1371/journal.pntd.0010631
• Peer Review
• Reader Comments

Dengue is among the fastest-spreading vector-borne infectious disease, with outbreaks often overwhelm the health system and result in huge morbidity and mortality in its endemic populations in the absence of an efficient warning system. A large number of prediction models are currently in use globally. As such, this study aimed to systematically review the published literature that used quantitative models to predict dengue outbreaks and provide insights about the current practices. A systematic search was undertaken, using the Ovid MEDLINE, EMBASE, Scopus and Web of Science databases for published citations, without time or geographical restrictions. Study selection, data extraction and management process were devised in accordance with the ‘Checklist for Critical Appraisal and Data Extraction for Systematic Reviews of Prediction Modelling Studies’ (‘CHARMS’) framework. A total of 99 models were included in the review from 64 studies. Most models sourced climate (94.7%) and climate change (77.8%) data from agency reports and only 59.6% of the models adjusted for reporting time lag. All included models used climate predictors; 70.7% of them were built with only climate factors. Climate factors were used in combination with climate change factors (13.4%), both climate change and demographic factors (3.1%), vector factors (6.3%), and demographic factors (5.2%). Machine learning techniques were used for 39.4% of the models. Of these, random forest (15.4%), neural networks (23.1%) and ensemble models (10.3%) were notable. Among the statistical (60.6%) models, linear regression (18.3%), Poisson regression (18.3%), generalized additive models (16.7%) and time series/autoregressive models (26.7%) were notable. Around 20.2% of the models reported no validation at all and only 5.2% reported external validation. The reporting of methodology and model performance measures were inadequate in many of the existing prediction models. This review collates plausible predictors and methodological approaches, which will contribute to robust modelling in diverse settings and populations.

Author summary

Dengue is considered as a major public health challenge and a life-threatening disease affecting people worldwide. Over the past decades, numerous forecast models have been developed to predict dengue incidence using various factors based on different geographical locations. Dengue transmission appears to be highly sensitive to climate variability and change, however quantitative models used to assess the relationship between climate change and dengue often differ due to their distribution assumptions, the nature of the relationship and the spatial and/or temporal dynamics of the response. We performed a systematic review to examine current literature surrounding existing quantitative models based on development methodology, predictor variable used and model performance. Our analysis demonstrates several shortcomings in current modelling practice, and advocates for the use of real time primary predictor data, the incorporation of non-climatic parameters as predictors and more comprehensive reporting of model development techniques and validation.

This review collates methodological approaches adopted in the modelling practices in the field across current literature. This will provide an evidence-based framework for upgrading future modelling practice to develop more accurate predictive models with robust techniques. In turn, this also provided an opportunity for the effective distribution of limited public health resources to prepare for demand.

Citation: Leung XY, Islam RM, Adhami M, Ilic D, McDonald L, Palawaththa S, et al. (2023) A systematic review of dengue outbreak prediction models: Current scenario and future directions. PLoS Negl Trop Dis 17(2): e0010631. https://doi.org/10.1371/journal.pntd.0010631

Editor: Husain Poonawala, Tufts Medical Center, UNITED STATES

Received: July 5, 2022; Accepted: January 29, 2023; Published: February 13, 2023

Copyright: © 2023 Leung et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: The author(s) received no specific funding for this work.

Competing interests: The authors declare that they have no conflicts of interest.

Introduction

Dengue fever is one of the fastest-spreading mosquitos-borne disease primarily of tropical and subtropical regions and is caused by various dengue virus strains [ 1 , 2 ]. In 2017 alone, over 100 million people were estimated to have acquired the infection, contributing to a globally increasing burden of disease [ 3 ]. Although most infections are mild, dengue shock syndrome and dengue haemorrhagic fever are severe forms of infections and can be fatal [ 4 , 5 ]. The case-fatality rate can be as high as 20% in the absence of prompt diagnosis and lack of specific antiviral drugs or vaccines [ 6 , 7 ], particularly in resource-limited settings. When an outbreak is particularly large, the influx of severe dengue cases can overwhelm the health system and prevent optimal care. Dengue also imposes an enormous societal and economic burden on many of the tropical countries where the disease is endemic [ 8 ]. An accurate prediction of the size of the outbreak and trends in disease incidence early enough can limit further transmission [ 5 ], and is likely to facilitate planning the allocation of healthcare resources to meet the demand during an outbreak.

Vector-borne pathogens characteristically demonstrate spatial heterogeneity—a result of spatial variation in vector habitat, climate patterns and subsequent human control actions [ 9 – 11 ]. The interplay of human, climate and mosquito dynamics give rise to a complex system that determines the pattern of dengue transmission, which in turn influences the potential for outbreak [ 12 ]. These relationships have been explored over the decades in the development of predictive models worldwide. Models vary widely in their purposes [ 13 – 15 ] and settings [ 16 – 21 ]. Many of these models excel at different tasks, however for a prediction model to be efficient, it requires a systematic, self-adaptive and generalizable framework capable of identifying weather and population susceptibility patterns across geographic regions. The scientific community has not yet agreed upon a model that provides the best prediction. The selection of predictors for the existing models is also quite heterogeneous. Some models rely solely on climate variables [ 16 ], some include vector characteristics [ 17 , 18 ] others use population characteristics [ 19 – 21 ]. A wide range of statistical techniques are used with varying degrees of accuracy and robustness among the existing models [ 16 – 21 ].

Clarity in the documentation of the model development processes and model performance are essential for ensuring the robustness of the prediction [ 22 ], which is scarce as many of the existing models have not yet been systematically appraised. Given the disparate approaches, a focused synthesis and appraisal of the existing models, along with their building techniques and factor catchments, is required. Carefully establishing these details will provide the foundation for updating and developing robust models in future. This study aimed to systematically review all published literature that reported quantitative models to predict dengue outbreaks, revealing several shortcomings in the usage of real time primary predictive data and non-climatic predictors in the development of models, as well as inadequate reporting of techniques, model and performance measure validation.

Search strategy and selection criteria

This systematic review’s aim, search strategy and study selection process were devised in accordance with the seven items in the Checklist for Critical Appraisal and Data Extraction for Systematic Reviews of Prediction Modelling Studies (‘CHARMS’) framework [ 23 ]. CHARMS framework is a systematic review tool, devised to facilitate and guide the methodological aspects the systematic review of prediction modelling studies, ranging from question development, appraisal of studies, and data extraction thereof. Detail of the CHARMS checklist can be found elsewhere [ 23 ]. The review followed the Preferred Reporting Items for Systematic Review and Meta-Analysis (‘PRISMA’) guidelines [ 24 ], and was registered in PROSPERO (CRD42018102100).

A literature search was conducted from inception until October 2022 using the electronic databases of Ovid MEDLINE, Embase, Scopus and Web of Science to obtain the information on the statistical models for predicting the number of dengue cases based on climatic factors. Google Scholar and the bibliography of included papers were also searched. The search strategies were developed under the guidance of an information specialist from Monash University Library. For the purposes of this study, dengue fever or dengue haemorrhagic fever or dengue shock syndrome were considered as a single entity “dengue”. Search strategy included Medical Subject Headings (‘MeSH’) and keyword terms including “dengue”, “severe dengue,” “weather,” “climate change,” “model,” “predict,” and “forecast.” The detailed search strategy and history are presented in S1 Table .

The review included studies focused on (1) prognostic prediction models which aim to review models predicting future events, (2) incidence of dengue fever or dengue haemorrhagic fever cases, (3) models to be used to predict the number of cases prior to an outbreaks, (4) models intended to inform public health divisions of future dengue outbreaks, (5) models with no restrictions on the time span of prediction and (6) prediction model development studies without external validation, or with external validation in independent data. Peer-reviewed original articles that presented a model and were available as full-text articles were considered eligible if they focused on predicting the number of dengue cases or an outbreak based on number of dengue incidence. Articles that focused on updating previously developed models were only included if they presented an updated version of the model. Articles which dealt exclusively with dengue in international travellers, or which only analyse the correlation between climate parameters and dengue cases without presenting a prediction model were excluded. Furthermore, articles which used models for predicting the population of dengue vectors (e.g., Aedes aegypti or Aedes albopictus ) as well as articles which only offer susceptible-infected-recovered modelling stochastic or transmission rates modelling were excluded. Articles which presented a model only dealing with spatial or temporal components of dengue risk were considered ineligible. Conference proceedings, book chapters, abstracts or letters were also excluded. Titles and abstracts of the retrieved articles were screened independently by two reviewers (RMI, MMA). Two review team members (LM, XYL) then retrieved the full text of those potentially eligible studies and independently assessed their eligibility. Disagreements were resolved by a third reviewer (MNK). A detailed study selection process is illustrated in the PRISMA flow diagram ( Fig 1 ) [ 24 ].

• PPT PowerPoint slide
• PNG larger image
• TIFF original image

https://doi.org/10.1371/journal.pntd.0010631.g001

Data analysis

Based on the data extraction fields of the CHARMS framework [ 23 ], a standardised table was developed to extract data from the selected studies for assessment of quality and evidence synthesis. The data extraction table consists of eleven domains, each with a specific item, that extract data from the reports of the primary forecasting model. Key information extracted from the included articles were period and geographical region, sources of data, outcomes to be predicted, modelling covariates variables, sample size, statistical techniques, model performances, model evaluation, and key findings. Information regarding handling and/or reporting of missing data was also extracted. Each paper was independently reviewed by two reviewers (MMA, XYL) and discrepancies were resolved through discussion with each other or with a third reviewer (SP) where necessary.

Extracted data from the selected studies were summarised and the key information about the methodological characteristics of these models were tabulated. Descriptive statistics were generated based on model characteristics and comparative methodological features such as outcome types, target population, data sources and predictor selection techniques. All statistical analyses were performed using Stata (version 17.0).

The initial search yielded 6553 studies. After duplicates were removed, 3244 studies were screened for titles and abstracts. This led to 153 studies for full text review, and 64 that strictly met the inclusion criteria ( Fig 1 ), 16 of these studies reported multiple models. A total of 99 models from 64 selected studies were identified. Characteristics of the models including, year, country and source of data used, predictors and outcome of the models, overall model development technique and model performance related variables are summarised in Table 1 [ 14 , 15 , 17 – 21 , 25 – 81 ].

https://doi.org/10.1371/journal.pntd.0010631.t001

Table 2 presents the sources of data used for modelling. Most of the models (90.7%) sourced dengue incidence data from surveillance and 44.3% used registry data, while 34.0% also used hospital or laboratory data. While most (94.7%) of the models used climate data from government agency reports, only around 22.1% of the models used data from the meteorological stations in real-time. Climate change data was also sourced mostly (77.8%) from government agency reports, only 11.1% used international environmental agency data and 22.2% used local environmental agency report. Half (50.0%) of the models used vector data from entomological surveillance and 25.0% used vector data from laboratory sources. Around 83.8% of the models were built based on the sample from general population, 16.2% used only urban samples. Around 46.9% of the models used monthly aggerate data, over a third (29.3%) used weekly aggregate data and 23.2% used daily aggregated data of the predictors. The majority (59.6%) of the models incorporated reporting time lag adjustment. Although 17.2% of the models addressed the missing data, 30.3% did not address the issue, while the majority (52.5%) did not specifically report the missing value. Around 80.8% of the models were intended to predict the number of dengue cases and 19.2% focused on predicting dengue outbreaks, based on predetermined case number threshold.

https://doi.org/10.1371/journal.pntd.0010631.t002

Table 3 summarises the statistical methods adopted by the prediction models. Modelling techniques were broadly categorised under two genres, statistical models (60.6%) and machine learning (39.4%). The statistical models were broadly comprised of linear regression models (18.3%), time series/autoregressive models (26.7%), Poisson regression models (18.3%) and generalized additive models (16.7%). Neural networks models (23.1%), random forest models (15.4%), and ensemble models (10.3%) were types of machine learning models used.

https://doi.org/10.1371/journal.pntd.0010631.t003

All theoretically plausible predictors were considered as candidate predictors in 71.7% of models and pre-selection of predictors based on unadjusted association with the model outcome was considered in 28.3% of models. Reporting of essential modelling techniques was heterogeneous– 84.8% of models reported model performance, 58.6% reported model calibration and 47.5% reported model discrimination. Among the performance metrices, Root Mean Squared Error (‘RMSE’) (11.1%), Mean Squared Error (‘MSE’) (7.3%), Mean Absolute Percentage Error (‘MAPE’) (5.1%), and Receiver Operating Characteristic (‘ROC’) (5.1%) were notable. Of these models, most (75.8%) reported the internal validation alone, only 5.2% reported both internal and external validation and 20.2% reported no validation at all. The validation techniques included: split sample validation (development and validation) (20.3%), cross validation, which involves resampling of the derivation sample (40.5%) and performance metrics (29.1%).

Table 4 presents the factors used for prediction models. All of the models included in the review used climate predictors in their model. Among the climate predictors: humidity (77.4%), temperature (95.2%) and rainfall (81.0%), were used in most models. Windspeed and direction (27.4%), precipitation (15.5%) and sunshine (10.7%) were among other notable climate factors. Considering the similarity of the description of factors, climate change and environmental factors were collapsed in to one category under climate change. Overall, 18.2% of the models used climate change and/or environmental predictors. El Nino-Southern Oscillation (‘ENSO’), Southern Oscillation Index (‘SOI’), Oceanic Nino Index (‘ONI’), hydric balance and vegetation index were among the key climate change predictors. Vegetation Index and enhanced vegetation index were among the key environmental factors reported.

https://doi.org/10.1371/journal.pntd.0010631.t004

Vector-related predictors were included in 8.1% of models, and the key vector related predictors were container index, Breteau index, adult productivity index, breeding percentage and mosquito infection rate. Demographic predictors were included in 8.1% of models, and key demographic predictors were, population size, population density, area under the urban settlement, access to piped water, education coverage and GDP per capita ( Table 4 ).

The combination of the predictors used in the model are depicted in Fig 2 . While majority (70.7%) of the models were built solely on climate predictors, none of the models used the combination of all four (climate, climate change, vector and demography) categories of predictors. The combination of climate, climate change and demographic predictors was used in 3.1% of the models and the combination of climate and climate change predictors were used in 13.4% models. Among other notable combinations were, climate and vector predictors (6.3%) and climate and demographic predictor (5.2%).

https://doi.org/10.1371/journal.pntd.0010631.g002

This systematic review evaluated 99 dengue outbreak prediction models from 64 studies, predicting the number of dengue cases or outbreaks from a variety of settings and populations. Our review identified, three major area of inadequacy in the current modelling practices. Firstly, use of secondary predictor data—acquired from reports—were quite prevalent among models. Secondly, as data for other non-climate variables were not included in the majority of the models, they failed to capture a holistic view of dengue development in the prediction process. Lastly, inadequacy in the reporting of methodology, model validation and performance measures were quite prevalent in the existing prediction models. One positive aspect seen in the current modelling practice is the shift toward robust modelling technique, such as use of machine learning algorithm and autoregressive time series techniques.

While effective treatments and prevention measures are still being developed, an early warning system for an epidemic has the potential to reduce the toll of severe disease on the health system and population [ 82 ]. Developing a clearer understanding of the factors affecting dengue transmission is an important step towards mitigating the impact of the disease on health systems and on communities at large. Early prediction of dengue incidences or alerts regarding impending outbreak may contribute to the health system preparedness through effective resource mobilization and creating public awareness. Such predictions also have policy implications, as epidemiological evidence generated through modelling feeds the policy making process and facilitates the prioritization of interventions, such as vector control and environmental modification particularly in regard to climate change [ 83 ]. Considering dengue is a mosquito-borne disease, the majority of outbreak prediction models focus on climate dependency of mosquito breeding and dengue transmission [ 4 – 7 ]. While many models have been successful in predicting relative cases of dengue in real settings, incorrect prediction results have been observed in several included studies. For example, a model by Adde et al. [ 26 ] was unable to forecast a dengue outbreak in 2001–2005 with the use of climate data from 1991–2000. One of the potential reasons for their inaccurate prediction is the geo-spatial variation of climate and environment within regions. In their study, the decision to include vastly heterogenous geographical areas led to variation in model prediction, which—be due to exclusion of non-climatic factors—may be the explanation of the poor performance in many of the earlier prediction models could. An increasing number of later models appears to incorporate a wide range of vector parameters as well as demographic parameters. Chang et al. pointed out that, entomological (vector) factor combined with other meteorological (climate) factors, have better prediction performance, and their prediction accuracy is often higher than that of climate predictors alone [ 21 ].

For dengue incidence data, the majority of the models relied on reports from government organizations based on notifiable data. Notification involves passive surveillance, where there is potential for systematic underreporting along with varying time lag. Modelling with data from active surveillance or real-time study may minimize such limitations. A considerable number of models did not consider the time lag affecting the prediction, which may be responsible for possible delays in weather affecting mosquito vectors and subsequently viruses. Due to the nature of dengue disease dynamics, failure to address time lag in model development is likely to affect prediction accuracy. Critical points in the natural history of disease timeline those may generate time lag may start with mosquito development, and subsequently also during acquisition and amplification virus in mosquitoes, mosquito host behaviour (i.e. biting and feeding pattern) and the incubation period of the virus in the human body [ 12 , 48 ]. Some studies have found a positive correlation between climate variables with time-lags at several points in the natural history of disease timeline [ 48 , 53 ]. Therefore, the adjustment for the time lags while predicting dengue is indispensable, especially when meteorological data is used [ 12 ].

The majority of included models were built on conventional regression techniques. According to recent literature, the time series technique is particularly considered effective in predicting the highly auto-correlated nature of dengue infection [ 84 , 85 ]. Machine learning techniques are employed in around 40% of the included models, and is particularly prevalent among the recently developed models. Batista et al. confirmed superiority with ML techniques demonstrating a lower error rate compared to the conventional statistics-based model in predicting dengue cases. In the age of big data, this technique can leverage data availability and in addition to being non-parametric in nature, can also provide some leeway in terms of strict assumption [ 86 ]. Random forest, neural networks, gradient boosting and support vector algorithms are notable subsets of machine learning algorithms, which have made significant contributions to several areas of public health, particularly in the forecasting of infectious diseases like malaria [ 87 ] and COVID-19 [ 88 ], and may have similar utility for making dengue outbreak predictions. Although machine learning in gaining popularity, future modelling in this area may benefit from using mechanistic models [ 89 ]. This modelling technique have played an essential role in shaping public health policy over the past decades [ 90 ]. Mechanistic models have the potential to provide additional insight regarding precise dynamics of the transmission and infection of dengue. As these models highlight underlying processes that drive the patterns. These models can particularly aid in the prediction through incorporating the observed trajectory of vectors.

In the modelling process, generating an algorithm or equation is only part of the process. It is not complete unless its performance has been assessed considering discrimination [ 91 ] and calibration [ 92 ], both internally and using the population outside of what it is developed from, respectively. Among the existing models examined, reporting of the discrimination and calibration is very low. Without knowledge of model performance through validation in both source populations and populations other than where it was developed, objective evaluation of models is difficult [ 93 ]. Predictive models can be of great value only if there is certainty of its accuracy, that is, how precisely the model can predict an outcome in real world [ 94 ]. In the majority of the published models, real-world validation has not been performed or reported. Generally, models are unlikely to predict as well in real-world samples as it would in the derivation sample; this validity shrinkage can often be quite substantial. Hence, future models should report a mechanism of estimating and reporting potential validity shrinkage as well as predictive validity in real world data [ 95 , 96 ].

In a substantial proportion of the models that reported validation, the original dataset was randomly split into the development and validation subset. Although this approach is widely used in many model validation settings, there are some setbacks when using smaller operational sample sizes, as split-sample analyses give overly pessimistic estimates of model performance and are accompanied by large variability [ 97 ]. Bootstrapping is generally considered to be the preferred internal validation method in predictive models [ 98 , 99 ]. Interestingly, bootstrapping was not used in any of the models in included studies, instead cross-validation technique was adopted in most of them. External validation, on the other hand, was used only in very few included studies. This is despite the fact that external validation is considered pivotal to model development and a key indicator of model performance through highlighting applicability to participants, centres, regions or environments [ 23 ]. The external validation is particularly essential for model redevelopment, where the original model is adjusted, updated, or recalibrated based on validation data to improve performance [ 100 ]. This update may include adjusting the baseline risk (interception or hazard) of the original model, adjusting the weight or regression coefficient of the predictor, adding new predictors, or removing existing predictors from the model.

This review has a number of strengths–specifically, the use of the CHARMS checklist [ 23 ], designed for the assessment of the applicability of the prediction models. In addition, inclusion and exclusion criteria were strictly followed, and database searches were conducted by an expert librarian. However, there are a few limitations of the review–the models in this review are not explicitly rated based on quality or performance due to the lack of accepted criteria for rating the quality of forecasting models. In addition, although calibration was reported in several studies, calibration measures lack clarification, which may impact the overall evaluation of the model performance. The model performance could not be compared across methodological approaches in quantitative synthesis because of a lack of model performance data, and those that did provide data are mostly generated from internal validation data which may result in overfitting.

In conclusion, failure to use of real time primary predictor data, failing to incorporate non-climatic parameters as predictor and insufficient reporting of model development techniques, model validation and performance measure were the major inadequacies identified in the current modelling practice. The paradigm shift towards robust modelling techniques, such as the use of machine learning algorithms and autoregressive time series, is a significant positive trend in contemporary model practices. The findings of this review have the potential to lay the groundwork for improved modelling practices in the future. These findings will contribute to robust modelling in different settings and populations and have important implications for the planning and decision-making process for early dengue intervention and prevention.

Supporting information

S1 table. search strategy for ovid medline, as performed in october 2022..

https://doi.org/10.1371/journal.pntd.0010631.s001

S2 Table. PRISMA checklist.

https://doi.org/10.1371/journal.pntd.0010631.s002

• View Article
• PubMed/NCBI
• Google Scholar
• 9. World Health Organization. Dengue and severe dengue. 2022 Jan 10 [cited 2022 July 27]. In: WHO Fact Sheets [Internet]. Geneva: World Health Organization. Available from: who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue .
• 43. Dharmawardhana KGS, Lokuge JN, Dassanayake PSB, Sirisena ML, Fernando ML, Perera AS, et al. Predictive model for the dengue incidences in Sri Lanka using mobile network big data. In: 2017 IEEE International Conference on Industrial and Information Systems (ICIIS); 2017 Dec 15–16; Peradeniya, Sri Lanka. Piscataway, New Jersey: Institution of Electrical and Electronics Engineers; 2017. p. 1–6. https://doi.org/10.1109/ICIINFS.2017.8300381
• 58. Nan J, Liao X, Chen J, Chen X, Chen J, Dong G, et al. Using Climate Factors to Predict the Outbreak of Dengue Fever. In: 2018 7th International Conference on Digital Home (ICDH); 2018 Nov 30—Dec 1; Guilin, China. International Conference on Digital Home (ICDH); 2018.p. 213–8. https://doi.org/10.1109/ICDH.2018.00045
• 62. Pham DN, Aziz T, Kohan A, Nellis S, Jamil JBA, Khoo JJ, et al. How to efficiently predict dengue incidence in Kuala Lumpur. In: 2018 Fourth International Conference on Advances in Computing, Communication & Automation (ICACCA); 2018 Oct 26–28; Subang Jaya, Malaysia. Piscataway, New Jersey: Institution of Electrical and Electronics Engineers; 2018. p. 1–6. https://doi.org/10.1109/ICACCAF.2018.8776790

• Research article
• Open access
• Published: 22 August 2014

Climate change and the emergence of vector-borne diseases in Europe: case study of dengue fever

• Maha Bouzid 1 ,
• Felipe J Colón-González 2 , 3 ,
• Tobias Lung 4   nAff5 ,
• Iain R Lake 2 &
• Paul R Hunter 1  

BMC Public Health volume  14 , Article number:  781 ( 2014 ) Cite this article

28k Accesses

102 Citations

151 Altmetric

Metrics details

Dengue fever is the most prevalent mosquito-borne viral disease worldwide. Dengue transmission is critically dependent on climatic factors and there is much concern as to whether climate change would spread the disease to areas currently unaffected. The occurrence of autochthonous infections in Croatia and France in 2010 has raised concerns about a potential re-emergence of dengue in Europe. The objective of this study is to estimate dengue risk in Europe under climate change scenarios.

We used a Generalized Additive Model (GAM) to estimate dengue fever risk as a function of climatic variables (maximum temperature, minimum temperature, precipitation, humidity) and socioeconomic factors (population density, urbanisation, GDP per capita and population size), under contemporary conditions (1985–2007) in Mexico. We then used our model estimates to project dengue incidence under baseline conditions (1961–1990) and three climate change scenarios: short-term 2011–2040, medium-term 2041–2070 and long-term 2071–2100 across Europe. The model was used to calculate average number of yearly dengue cases at a spatial resolution of 10 × 10 km grid covering all land surface of the currently 27 EU member states. To our knowledge, this is the first attempt to model dengue fever risk in Europe in terms of disease occurrence rather than mosquito presence.

The results were presented using Geographical Information System (GIS) and allowed identification of areas at high risk. Dengue fever hot spots were clustered around the coastal areas of the Mediterranean and Adriatic seas and the Po Valley in northern Italy.

Conclusions

This risk assessment study is likely to be a valuable tool assisting effective and targeted adaptation responses to reduce the likely increased burden of dengue fever in a warmer world.

Peer Review reports

Several vector-borne diseases are spread in Europe and the effect of climate change on disease distribution has been extensively discussed [ 1 – 5 ]. Most authors consider that climate change is likely to have greatest impact on dengue fever, West Nile fever, chikungunya fever, malaria, leishmaniasis, tick-borne encephalitis, Lyme borreliosis, Crimean-Congo haemorrhagic fever, spotted fever rickettsioses, Yellow fever and Rift Valley fever. One disease that has received much interest in recent years is dengue fever. Dengue is a mosquito-borne disease caused by an RNA virus of the genus Flavivirus . Uncomplicated dengue can present with fever, headache and muscle and joint pains. A proportion of infections can develop into severe forms namely dengue haemorrhagic fever and dengue shock syndrome, which are associated with higher mortality rates. Dengue fever is endemic in over 100 countries in Africa, the Americas, the Eastern Mediterranean, South-east Asia and the Western Pacific, with the last two regions being the most seriously affected [ 6 ]. It is estimated that over 50 million new dengue fever infections and approximately 12,000 deaths, mainly among children, occur worldwide every year [ 7 ].

There has been a significant global increase in dengue incidence and it is currently considered the most important human arboviral disease worldwide. The successful spread of dengue has been attributed to various factors including population growth, urbanization, global travel, and environmental conditions. In Europe, dengue fever is rare but cases are imported every year by tourists returning from endemic areas. Recently, autochthonous dengue cases have been reported in Croatia and France, highlighting the suitability of these regions for dengue transmission [ 8 , 9 ]. These cases have raised concerns about the potential for the emergence of dengue fever in Europe especially with predicted climate change.

One of the reasons for these concerns is that dengue vectors are already present within Europe. Aedes (Stegomyia) aegypti (Linneaus) is the major urban vector of dengue worldwide [ 10 ]. A. aegypti is closely associated with humans and human habitations. Female mosquitoes lay their eggs on or near water surface in natural or artificial containers [ 10 , 11 ]. Aedes albopictus is the secondary vector of dengue fever and is adapted to the peridomestic environment [ 12 ]. According to the “European Network for arthropod vector surveillance for human public health” (VBORNET) ( http://www.vbornet.eu/ , last accessed June 2014), A. albopictus is present in many European countries: Spain, France, Switzerland, Italy, Slovenia, Croatia, Bosnia and Herzegovina, Serbia, Montenegro, Albania, Greece, Monaco, San Marino, Bulgaria, the Netherlands and Russia. By contrast, A. aegypti has only been reported from Madeira, the Netherlands, Georgia and southern Russia.

There is much debate about how future climate change will affect dengue risk, especially in countries where the disease is not currently endemic [ 10 , 13 , 14 ]. Recent studies have modelled the future dengue distribution under predicted climate change either on a global scale [ 15 – 19 ] or in endemic countries [ 20 , 21 ]. These models have suggested a latitudinal and altitudinal expansion of the geographical range of dengue.

In Europe, there have been too few dengue cases to conduct a rigorous analysis. Consequently, estimation of dengue risk has so far relied on past, current and projected future distribution of A. albopictus [ 22 ] . Although presence of the vector is necessary for dengue to become endemic, vector presence is not sufficient in itself to determine disease occurrence [ 23 ]. The objective of this study is to model dengue risk based on clinical data. We have used one of the largest and more spatially diverse dengue dataset yet assembled to compute significant relationships between dengue and weather parameters [ 24 ]. Subsequently, the model outputs were used to project dengue risk across Europe under climate change scenarios.

Mexican data

The dengue dataset was primarily developed for a study of the effects of weather on dengue incidence across Mexico [ 24 ]. Dengue data comprised state-specific monthly reports of laboratory confirmed dengue cases, retrieved from the Mexican Health Secretariat ( http://www.epidemiologia.salud.gob.mx/anuario/html/anuarios.html , last accessed June 2014) for the period January 1985 to December 2007. Monthly average minimum and maximum temperatures and monthly precipitation for each state were provided by the Mexican National Meteorological Service. Monthly mean humidity was retrieved from the National Centers for Environmental Prediction and National Center for Atmospheric Research (NCEP/NCAR) “Reanalysis 1” ( http://www.esrl.noaa.gov/psd/data/gridded/data.ncep.reanalysis.pressure.html , last accessed June 2014). Yearly Gross domestic product (GDP) per capita (PPP in constant 2005 international dollars) was obtained from the World Bank at the national level ( http://data.worldbank.org/country/mexico , last accessed June 2014). State-specific GDP estimates were computed as previously described [ 24 ]. The proportion of people living in urban areas was retrieved from the Mexican Chamber of Deputies ( http://www.cefp.gob.mx/intr/bancosdeinformacion/estatales/indicadores_socioeconomicos/is003.xls , last accessed June 2014). Population density was calculated by normalising population to state area size. Table  1 presents the summary statistics for these variables.

Model calibration

Generalized Additive Models (GAMs) are semi-parametric extensions of the generalized linear model (GLM), where the linear predictor Σ β j X j is replaced by a sum (hence the name additive) of smooth functions of covariates Σ s j ( X j ) [ 25 ]. Like in GLMs, GAMs allow the exploration of nonlinear data structures in the context of exponential family distributions (e.g. Poisson and Binomial), and use link functions to establish relationships between the mean of the outcome variable and the predictors [ 26 , 27 ]. Unlike GLMs, GAMs automatically identify and estimate the optimal degree of nonlinearity of the model directly from the data [ 28 ]. In our study, the expected number of dengue cases E ( y ti ) ≡  μ it for State i at time t was assumed to follow an overdispersed Poisson distribution described by:

where g (.) is a log link function of the expectation μ it  ≡  E ( y ti ) with y ti denoting the time series of dengue counts. The logarithm of the population ( ξ ) at time t and state i is included as an exposure variable to standardise the dengue data by population. Weather has a delayed effect on dengue incidence. Therefore, we specified our j -th meteorological variables X jti within biologically and physically plausible time lags based on literature reports in Mexico [ 29 – 31 ]. Weather variables comprised average monthly minimum (Tmin) and maximum (Tmax) temperatures, monthly precipitation (Precip) and average monthly relative humidity (Humid). All weather parameters were lagged 1 and 2 months (Tmin 1:2 , Tmax 1:2 , Precip 1:2 , Humid 1:2 ). The term s j (.) corresponds to univariate smooth functions defined by penalized cubic regression splines. We adjusted our model for the effects of socioeconomic variables Z kit represented by GDP per capita, the proportion of the population living in urban settlements and population density. Socioeconomic variables entered the model linearly. Analyses were conducted in R version 2.15.0 [ 32 ].

Many epidemiological datasets are likely to be dominated by long-term and seasonal trends. Therefore, adjusting the regression models for these patterns is necessary to separate them from the effects of weather parameters on the health variable [ 33 ]. Our model does not account for seasonal trends as seasonality for Europe is unlikely to be similar to Mexico given the wider range of temperatures between summer and winter. Although mosquito presence is a key factor in the epidemiology and occurrence of the disease, to our knowledge there are no state-specific long-term time series of mosquito presence across Mexico. Consequently, data on mosquito presence could not be incorporated into our model. The GAM-estimated relationships between dengue, weather and socioeconomic development in Mexico were then used to project dengue fever risk across Europe.

European data and dengue fever risk modelling

European climate data were retrieved from the regional climate model COSMO-CLM (CCLM), forced with output from the coupled atmosphere–ocean global climate model (GCM) ECHAM5/MPIOM [ 34 ]. These regional simulations represent aerosol and GHG forcing according to the A1B scenario of the Special Report on Emissions Scenarios (SRES) of the IPCC [ 35 ]. A1B corresponds to a projected increase in global surface temperature of 2.8°C in 2090–2099 (relative to 1980–1999) and a likely range of up to 4.4°C [ 36 ]. It assumes rapid economic growth, rapid introduction of efficient technologies, convergence among regions and a balance across energy sources. The regional climate data correspond to the period 1961–2100, with a domain covering the entire European continent at a resolution of about 18 × 18 km. Data were re-scaled to a grid cell size of 10 × 10 km for the purpose of this study. The same four monthly climatic variables (Tmin, Tmax, Precip, Humid) lagged 1 and 2 months, as used for model calibration with the Mexican data, were calculated over four time periods, (a) baseline 1961–1990, (b) short-term scenario 2011–2040, (c) medium-term scenario 2041–2070, and (d) long-term scenario 2071–2100.

GDP per capita data were retrieved from EUROSTAT (in Euros) and converted into constant 2005 international dollars to be concordant with the Mexican data used for model calibration. Country level data from the World Development Indicators dataset ( http://databank.worldbank.org/data/Databases.aspx , last accessed June 2014) were disaggregated to NUTS-3 level (Nomenclature of territorial units for statistics) by using the NUTS-3 level shares for each country as calculated from EUROSTAT. Then, an areal weighting approach was employed to convert the NUTS-3 data into the 10 × 10 km grid (see Additional file 1 ). Areal weighting is commonly used to transform administrative boundary data to raster format, whereby each grid cell is assigned a value according to the percentage of its area covered by the overlying administrative region [ 37 ].

The proportion of population living in urban areas and total population data were retrieved from the GEOSTAT 2006 population grid dataset of the European Forum for Geostatistics (EFGS) ( http://www.efgs.info/ , last accessed June 2014) at a spatial resolution of 1 × 1 km. Urban clusters were defined by two criteria first each grid cell of 1 × 1 km must have a minimum population density of 300 people per km 2 and second clusters of adjoining grid cells must accommodate at least 5000 people, in line with the definitions used by the European Commission [ 38 ]. The total number of urban population for each 10 × 10 km grid cell was extracted and divided by total population to obtain proportion of population in urban area (see Additional file 1 ). Due to the lack of projections both in terms of SRES scenario and spatial detail, the socioeconomic variables were held constant at their mean value for baseline conditions in order to isolate the effects of climate.

Mapping of dengue fever risk

The model was used to project monthly dengue cases, which were aggregated to calculate the average number of cases per year for each time period. These were used to generate dengue risk maps using ArcGIS 10.1 ( http://www.esri.com/software/arcgis , last accessed June 2014). In total, four maps were produced corresponding to the time periods of study. Identical class sizes were applied across all four time periods in order to ensure that value changes could be observed over time. The map series employ a bipolar hue progression [ 39 ] ranging from green (no/low risk areas) to bright red (areas with the highest dengue risk). Moreover, a second map series was generated, that normalises dengue cases by total population to derive dengue incidence. We used colours ranging from blue for no/low risk to cherry brown for high risk areas. In addition, standard error for each grid cell was calculated. Standard error values were subjected to the same aggregation and averaging procedure as for dengue number of cases and dengue incidence and were used to produce maps of uncertainty.

The dengue-weather relationships estimated by our Poisson GAM based on the Mexican data are presented in Table  2 . The model explained 44% of the deviance within the Mexican dataset. Figure  1 shows the estimated effects of weather variables on number of dengue cases. All climate parameters were statistically significant in a highly non-linear way. The greatest effect was associated with monthly average of minimum temperature followed by monthly relative humidity (both variables lagged one and two months). For socioeconomic variables, population density, degree of urbanization and log population were all significantly associated with dengue incidence (Table  2 ).The GAM estimated relationships were used to project dengue fever risk in Europe under climate change conditions expressed as dengue cases (cases/year/10×10 km grid). For the baseline period (1960–1990), number of dengue cases are between 0 and 0.6 for most European areas, corresponding to an incidence of less than 2 per 100 000 inhabitants (Figures  2 and 3 ). Over time, an increase in dengue risk is projected, with highest incidence rates found for the long-term scenario 2070–2100. Indeed, for the baseline period hardly any grid cell had incidence rate exceeding 10 per 100 000 inhabitants, while a substantial amount of grid cells are within this category when considering the long-term-scenario, mostly localised in southern Europe. For each estimated dengue incidence, standard error was calculated and values presented as maps of uncertainty (Figure  4 ). The general trend was that standard errors tend to correlate with incidence rates, as would be expected from a Poisson model. The maps also highlight that the standard errors are not consistent across the continent.

GAM-estimated relationships between average monthly dengue cases and average monthly Tmin (A), Tmax (B), Humidity (C), and precipitation (D), all lagged 1 and 2 months. The x axis represents increasing variations in the meteorological covariates. The y axis indicates the contribution of the smoother to the fitted values. The y axis is labelled s(cov, edf), where cov indicates the name of the covariate, and edf represents the estimated degrees of freedom of the smooth function used to represent its relationship with number of dengue cases. The red lines indicate the maximum likelihood estimates, and the grey shaded areas represent the 95% confidence intervals. The rug at the bottom of the figures indicate observed values of the covariates.

Average expected number of dengue cases in Europe modelled using GAM model for baseline conditions and climate change scenarios for early, medium and late century. Number of cases was calculated for each 10 × 10 km grid.

It can be seen from Figures  2 and 3 that the risk is not equally distributed across Europe. Generally, southern Europe appears at higher risk, with most of the coastal areas being particularly affected. In contrast, northern Europe, the British Isles and most of central Europe show virtually no risk in the baseline period. Over time, the risk in southern Europe and in particular along the Mediterranean coast is projected to increase considerably, with highest incidence revealed along the Italian coast, the Po Valley region, the Spanish Mediterranean coast and southern Spain in general (Figures  2 and 3 ). In other parts of Europe a change from virtually no risk for the baseline period to incidence rate of up to 10 cases per 100 000 inhabitants are projected, such as in large parts of France, south-western Germany, Hungary, and the Balkan region. By contrast, in northern Europe, for most of the British Isles and the Baltic states, the risk is projected to remain virtually zero even for the long-term scenario 2070–2100.

Dengue fever incidence rate expressed as number of cases per 100 000 inhabitants per year for baseline conditions and climate change scenarios for early, medium and late century.

Maps of uncertainty showing standard errors for projected average number of dengue cases for baseline conditions and climate change scenarios for early, medium and late century.

We have presented the first ever projections of future dengue fever risk in Europe under climate change based on empirical modelling of laboratory confirmed dengue incidence as a function of climate and socioeconomic variables. Our study has shown that the risk of dengue fever is likely to increase in Europe under climate change, but that almost all of the excess risk will fall on the coastal areas of the Mediterranean and Adriatic seas and the North Eastern part of Italy, particularly the Po Valley. Although we have only modelled dengue fever, our findings may have implications for other mosquito-borne diseases such as Chikungunya, which share the same vector species and may have similar transmission patterns to dengue fever.

Previous work in the area has primarily focused on the expected future distribution of the Aedes vector [ 40 – 44 ]. Whilst such studies have proven helpful to determine the potential presence of the vector in a given area, the presence of the vector does not necessary translate into disease occurrence. Because our model is based on disease occurrence, the GAM-estimated relationships are likely to be more useful for estimating dengue risk across Europe than models based only on the mere presence of the mosquito. Nevertheless, our results are generally in agreement with the conclusions of projections based on vector distribution. One such example of concordance is Italy, which was identified as a potential dengue hot spot using both approaches (i.e. vector presence and dengue risk). The most noticeable discrepancies for dengue fever risk, however, were associated with Spain and France. In our study, southern and eastern Spain is associated with increased dengue risk, however, A. albopictus maps show that this area is likely to be unsuitable by mid/end century [ 40 – 43 ], probably because of hotter and drier weather conditions. On the contrary, France is considered here at medium risk (excluding Mediterranean areas), while it is considered an area of high suitability for A. albopictus [ 40 , 41 , 43 ]. Possible explanations for these discrepancies include different climate change scenarios and dissimilar climatic variables incorporated in modelling approaches. A recent study by Rogers and colleagues established a dengue risk map for Europe based on a global risk map taking into account vector presence, disease occurrence and various environmental factors [ 45 ]. They showed that while most Europe is at low risk, most major cities combining warmer temperatures and higher population density are highly suitable for dengue transmission. However, as the authors acknowledged, several other factors can influence disease occurrence and transmission. In our study, most cities are not at an increased risk until mid to end of the century. Understandably, it is difficult to compare two risk maps generated using different methodologies and data sets. Nevertheless, European dengue hot spots identified in this and other studies should be made aware of the projected risk.

Herein, we identified a large European geographical area permissive for dengue fever transmission. Whether dengue will become endemic in a particular area depends on various climatic and non-climatic factors, in addition to disease risk in neighbouring areas, which makes estimation of actual incidence problematic. Nevertheless, dengue is unlikely to become endemic in areas of moderate risk, especially if nearby areas have low risk. Consequently we would hypothesise that, should dengue fever become endemic in Europe, it is likely to be primarily in the Mediterranean and Adriatic coastal plains and the Po Valley area of Italy. This does not mean that localised outbreaks of dengue would not occur elsewhere, but that if they did, they would be less likely to be self-sustaining.

For the purpose of this study, we have used Mexican dengue fever surveillance data to project dengue incidence in Europe. This could be considered a limitation because of applicability to European settings and transferability issues. It would clearly have been preferable to use European dengue data but at present there have been too few cases in Europe for any meaningful analysis. In the absence of worthwhile European data, the Mexican dengue surveillance dataset is without doubt the best alternate source of empirical data. The Mexican dataset comprises the largest such set yet assembled with monthly data and sub-national resolution. Furthermore, Mexico is a large country comprising multiple climate zones and thus providing the opportunity of modelling climate impacts on dengue over a wide range of climatic conditions. Mexico is a middle income country, whose socioeconomic status could be comparable to some European countries http://data.worldbank.org/data-catalog/world-development-indicators (last accessed June 2014). Nevertheless, there are several mismatches. One particular issue is seasonal climatic variation, as seasons in Mexico may not match those in Europe. For example, Mexico is highly affected by the El Niño–Southern Oscillation [ 46 ], which does not have such an impact in Europe. Similarly, winter climatic conditions can be very different between Mexico and Europe, therefore influencing overwintering and survival of Aedes populations. In order to test for this variability, we fitted the model with and without the seasonal term and found that the shape of the estimated relationships graph was similar with a slight difference in order of magnitude. Additional file 2 shows the range of the two weather variables most significantly associated with dengue risk (Tmin and humidity). There is a major area of overlap between the two sufficient to give validity to the use of the Mexico data. The major European areas that do not overlap with Mexico are unlikely to be in areas at risk from dengue. Another important point to consider is the different socioeconomic conditions and cultural habits between Mexico and Europe. Whilst we were not able to model many of these differences due to the absence of adequate data, some of the variables may have little impact on overall dengue risk. For instance, GDP was not found to be significantly associated with dengue fever risk. However, this could be due to data constrains because GDP were available as yearly data that arose from linear interpolations based on 5 years interval. Taking into account these constraints, we have been careful not to be too specific about how many extra cases of dengue we are likely to see in Europe, rather on identifying high risk areas. Clearly even in highly conducive areas, dengue fever will not become endemic if it is not introduced at some point and so the development and spread of dengue endemicity is likely to be a stochastic process, nevertheless it is relying on vector presence, virus introduction and host susceptibility.

An important issue is that the model is produced for a country where dengue is endemic. If dengue was introduced into Europe, then it could spread rapidly in the early years of its establishment and become endemic. This is because almost all Europeans would be immunologically naïve and therefore actual cases could outstrip our projections. A further source of uncertainty would be the adaptation of the European health authorities to the emergence of dengue, including health practitioners’ awareness and effective diagnostic and treatment measures. However, even well-staffed health services with adequate infrastructure could struggle to manage dengue fever [ 23 ]. Further response measures that could lower transmission rate, while awaiting the development of an effective vaccine, should include integrated vector management. However, the effectiveness of vector control strategies is not always supported by adequate evidence based evaluations [ 47 ]. In addition, unless vector control is performed in a sustainable manner, it is most likely to be inefficient.

Another limitation of the study is related to the mosquito vector. Although, A. albopictus is present in Mexico, dengue is mainly transmitted by A. aegypti. This primary dengue vector is responsible for major dengue epidemics and the severe life- threatening form of the disease [ 12 ]. In Europe, A. aegypti is only present in Madeira, where it caused sporadic cases and a sustained dengue outbreak [ 48 ]. The main Aedes species in Europe is A. albopictus . This species is associated with sporadic dengue cases due to its limited competence related to its feeding behaviour and its relative recent adaptation to flaviviruses (including dengue fever virus) [ 49 ]. Consequently, our results are likely to over-estimate dengue risk in Europe. Additionally, some dengue virus serotypes were shown to cause more severe symptoms and spread more easily [ 50 ], therefore the impact of dengue introduction in Europe and subsequent transmission is influenced by virus-vector interaction and the associated risk and severity could either increase or decrease accordingly. Nevertheless, living standards in Europe are likely to limit dengue spread as has been reported in Texas [ 51 ], consequently, the actual dengue incidence could be much lower than projected using our model.

One finding that may cause some concern is that under baseline conditions some areas are identified as being at increased risk of dengue fever, when dengue in Europe is effectively non-existent. This is legitimate because the model is projecting areas where, given the provided meteorological and socioeconomic conditions, dengue fever may occur, independently of other confounding factors including vector presence, virus circulation and control measures. Undoubtedly, some European areas are permissive for dengue fever transmission as supported by endogenous cases in France and Croatia in 2010 [ 8 , 9 ]. The French cases were recorded in Nice, which was indeed highlighted as high risk area in our model. Croatian cases were on the Peljesac peninsula and the island of Korcula (outside the EU27 and therefore not modelled here). Furthermore, in 2007, there was an outbreak of Chikungunya (another viral disease spread by A. albopictus mosquitoes) that affected north eastern Italy on the Adriatric coast [ 52 , 53 ]. Although Chikungunya virus shows adaptive mutation for A. albopictus [ 49 ], not observed for dengue virus, this area is clearly permissive for the mosquito vector and is associated with the highest projected dengue fever risk in our model. These sporadic cases and outbreaks confirm the general spatial pattern of dengue risk as estimated by our model.

An issue valid for both Mexico and Europe is that Mexican dengue fever data is based on laboratory confirmed reported cases of infection. While on one hand, and in particular for Europe, our approach of modelling dengue risk based on reported cases is considered novel and unique, on the other hand such reports are known to substantially underestimate the actual number of cases because a significant proportion of infections are not diagnosed and reported. A limitation of dengue surveillance in Mexico is its reliance on a passive surveillance system based on unspecific symptoms, coupled with low awareness of health practitioners and limited access to reliable diagnostic tests. Estimation of the sensitivity of dengue surveillance systems varies inter and intra countries but it has been reported that for every recorded case, there may be somewhere between 10–27 cases that go unreported [ 54 ]. This could mean that the number of dengue fever cases could be substantially higher than estimated here. It is not known what the sensitivity of dengue surveillance systems in Europe would be, however, asymptomatic and mild cases could go undiagnosed.

In order to assess the impact of climate change on dengue risk in Europe, we used predictions based on the A1B scenario because it is considered more realistic in light of the current global emissions. This is particularly relevant when compared to other more extreme scenarios (such as the low emission SRES B1, or the newer RCP2.6 scenarios) that assume drastic CO 2 reductions globally in the coming decades, which is unlikely to happen. Running the current model using additional climate change scenarios would add value to the predictions and allow comparative analysis and could be done as a subsequent study. In order to assess the effect of climate change on dengue risk, all non-climatic variables were assumed to remain at their baseline levels, while this could be considered a limitation, some socioeconomic variables were not significantly associated with dengue risk. In addition, population and urbanisation projections for Europe show that minor changes are expected (with some local variation), especially when compared to other parts of the world (where significant increase in population size and urbanisation are expected until 2100) ( http://esa.un.org/wpp/ and http://esa.un.org/unpd/wup/ last accessed August 2014).

A recent systematic review of quantitative models assessing the impact of climate change on dengue transmission by Naish and colleagues [ 55 ] found that despite using different methodologies, most models consider that temperature is the most important climatic factor driving dengue transmission but that precipitation and humidity are also important, which is in accordance with our model. Despite some methodological issues, most models report increased climatic suitability and expansion of geographical range under various climate change scenarios and in different regions of the world [ 55 ]. Improved climate change scenarios and better understanding of vector-borne diseases biology and transmission are likely to contribute to more accurate disease risk models in the future.

This study allowed modelling of dengue fever risk in Europe based on actual clinical data. The model calibrated under Mexican conditions resulted in reliable and geographically meaningful patterns of projected dengue fever risk in Europe. The risk maps indicate that climate change is likely to contribute to increased dengue risk (and possibly other mosquito-borne diseases) in many parts of Europe, especially towards the end of the century. The areas of greatest increased risk are projected to be clustered around the Mediterranean and Adriatic coasts and in northern Italy. The exact incidence is dependent on several other factors, some of which we were unable to model at this stage (such as vaccine development). Nevertheless public health agencies in high risk areas need to plan, implement and evaluate active entomological reporting and sentinel clinical surveillance and should aim to improve awareness of the increased risk amongst health practitioners and the general public.

DH: Health effects of climate change in the UK 2008: an update of the department of health report 2001/2002. http://webarchive.nationalarchives.gov.uk/20130107105354/http://www.dh.gov.uk/en/Publicationsandstatistics/Publications/PublicationsPolicyAndGuidance/DH_080702 ,

Hunter PR: Climate change and waterborne and vector-borne disease. J Appl Microbiol. 2003, 94 (Suppl): 37S-46S.

Article   PubMed   Google Scholar  

McMichael AJ, Woodruff RE, Hales S: Climate change and human health: present and future risks. Lancet. 2006, 367: 859-869. 10.1016/S0140-6736(06)68079-3.

Semenza JC, Menne B: Climate change and infectious diseases in Europe. Lancet Infect Dis. 2009, 9: 365-375. 10.1016/S1473-3099(09)70104-5.

WHO: Protecting health from climate change: global research priorities. http://www.who.int/globalchange/publications/9789241598187/en/ ,

WHO: Dengue media centre: dengue and haemorrhagic fever. http://www.who.int/mediacentre/factsheets/fs117/en/ 2009

Lawrence J: DengueNet--WHO’s internet-based system for the global surveillance of dengue fever and dengue haemorrhagic fever (dengue/DHF). Euro Surveill Wkly Release. 2002, 6: 1883-

Google Scholar  

Gjenero-Margan I, Aleraj B, Krajcar D, Lesnikar V, Klobucar A, Pem-Novosel I, Kurecic-Filipovic S, Komparak S, Martic R, Duricic S, Betica-Radic L, Okmadzic J, Vilibic-Cavlek T, Babic-Erceg A, Turkovic B, Avsic-Zupanc T, Radic I, Ljubic M, Sarac K, Benic N, Mlinaric-Galinovic G: Autochthonous dengue fever in Croatia, August-September 2010. Euro Surveill. 2011, 16: pii=19805-

La Ruche G, Souares Y, Armengaud A, Peloux-Petiot F, Delaunay P, Despres P, Lenglet A, Jourdain F, Leparc-Goffart I, Charlet F, Ollier L, Mantey K, Mollet T, Fournier JP, Torrents R, Leitmeyer K, Hilairet P, Zeller H, Van Bortel W, Dejour-Salamanca D, Grandadam M, Gastellu-Etchegorry M: First two autochthonous dengue virus infections in metropolitan France, September 2010. Euro Surveill. 2010, 15: 19676-

CAS   PubMed   Google Scholar  

Jansen CC, Beebe NW: The dengue vector Aedes aegypti: what comes next. Microbes Infect. 2010, 12: 272-279. 10.1016/j.micinf.2009.12.011.

Rigau-Perez JG, Clark GG, Gubler DJ, Reiter P, Sanders RJ, Vorndam AV: Dengue and dengue haemorrhagic fever. Lancet. 1998, 352: 971-977. 10.1016/S0140-6736(97)12483-7.

Article   CAS   PubMed   Google Scholar  

Lambrechts L, Scott TW, Gubler DJ: Consequences of the expanding global distribution of aedes albopictus for dengue virus transmission. PLoS Negl Trop Dis. 2010, 4: e646-10.1371/journal.pntd.0000646.

Article   PubMed   PubMed Central   Google Scholar  

Hunter PR: Vector Borne Disease and Climate Change. Encyclopedia of Environmental Health. Edited by: Nriagu JNJ. 2011, Surrey, UK: Elsevier

Rogers DJ, Randolph SE: Climate change and vector-borne diseases. Adv Parasitol. 2006, 62: 345-381.

Degallier N, Favier C, Menkes C, Lengaigne M, Ramalho WM, Souza R, Servain J, Boulanger JP: Toward an early warning system for dengue prevention: modeling climate impact on dengue transmission. Clim Chang. 2010, 98: 581-592. 10.1007/s10584-009-9747-3.

Article   Google Scholar  

Hales S, de Wet N, Maindonald J, Woodward A: Potential effect of population and climate changes on global distribution of dengue fever: an empirical model. Lancet. 2002, 360: 830-834. 10.1016/S0140-6736(02)09964-6.

Hopp MJ, Foley JA: Worldwide fluctuations in dengue fever cases related to climate variability. Clim Res. 2003, 25: 85-94.

Rogers DJ, Wilson AJ, Hay SI, Graham AJ: The global distribution of yellow fever and dengue. Adv Parasitol. 2006, 62: 181-220.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Thai KTD, Anders KL: The role of climate variability and change in the transmission dynamics and geographic distribution of dengue. Exp Biol Med. 2011, 236: 944-954. 10.1258/ebm.2011.010402.

Article   CAS   Google Scholar  

Schmidt WP, Suzuki M, Thiem VD, White RG, Tsuzuki A, Yoshida LM, Yanai H, Haque U, Tho LH, Anh DD, Ariyoshi K: Population density, water supply, and the risk of dengue fever in Vietnam: cohort study and spatial analysis. Plos Med. 2011, 8: e1001082-10.1371/journal.pmed.1001082.

Sriprom M, Chalvet-Monfray K, Chaimane T, Vongsawat K, Bicout DJ: Monthly district level risk of dengue occurrences in Sakon Nakhon Province, Thailand. Sci Total Environ. 2010, 408: 5521-5528. 10.1016/j.scitotenv.2010.08.024.

Caminade C, Medlock JM, Ducheyne E, McIntyre KM, Leach S, Baylis M, Morse AP: Suitability of European climate for the Asian tiger mosquito Aedes albopictus: recent trends and future scenarios. J R Soc Interface. 2012, 9: 2708-2717. 10.1098/rsif.2012.0138.

Reiter P: Climate change and mosquito-borne disease. Environ Health Perspect. 2001, 109 (Suppl 1): 141-161.

Colon-Gonzalez FJ, Fezzi C, Lake IR, Hunter PR: The effects of weather and climate change on dengue. PLoS Negl Trop Dis. 2013, 7: e2503-10.1371/journal.pntd.0002503.

Hastie T, Tibshirani R: Generalized additive models. Stat Sci. 1986, 1: 297-318. 10.1214/ss/1177013604.

Guisan A, Edwards TC, Hastie T: Generalized linear and generalized additive models in studies of species distributions: setting the scene. Ecol Model. 2002, 157: 89-100. 10.1016/S0304-3800(02)00204-1.

Schimek MG: Semiparametric penalized generalized additive models for environmental research and epidemiology. Environmetrics. 2009, 20: 699-717. 10.1002/env.972.

Wood S: Generalized Additive Models: An Introduction With R. 2006, Boca Raton, FL, USA: CRC Press

Brunkard JM, Cifuentes E, Rothenberg SJ: Assessing the roles of temperature, precipitation, and ENSO in dengue re-emergence on the Texas-Mexico border region. Salud Publica Mex. 2008, 50: 227-234.

Colon-Gonzalez FJ, Lake IR, Bentham G: Climate variability and dengue fever in warm and humid Mexico. Am J Trop Med Hyg. 2011, 84: 757-763. 10.4269/ajtmh.2011.10-0609.

Hurtado-Diaz M, Riojas-Rodriguez H, Rothenberg SJ, Gomez-Dantes H, Cifuentes E: Short communication: impact of climate variability on the incidence of dengue in Mexico. Trop Med Int Health. 2007, 12: 1327-1337. 10.1111/j.1365-3156.2007.01930.x.

The R Development Core Team: R: A Language and Environment for Statistical Computing. 2010, Vienna: R Foundation for Statistical Computing

Bhaskaran K, Gasparrini A, Hajat S, Smeeth L, Armstrong B: Time series regression studies in environmental epidemiology. Int J Epidemiol. 2013, 42: 1187-1195. 10.1093/ije/dyt092.

Rockel B, Will A, Hense A: The Regional Climate Model COSMO-CLM(CCLM). Meteorol Z. 2008, 17: 347-348. 10.1127/0941-2948/2008/0309.

IPCC: Special Report on Emissions Scenarios: A Special Report of Working Group III of the Intergovernmental Panel on Climate Change. 2000, Cambridge; New York: Cambridge University Press

IPCC: Climate Change 2007: The Physical Science Basis. 2007, Cambridge: Cambridge University Press

Mennis J: Generating surface models of population using dasymetric mapping. Prof Geographer. 2003, 55: 31-42.

Dijkstra L, Poelman H: Regional Typologies: A Compilation. Regional Focus – A Series of Short Papers on Regional Research and Indicators Produced by the Directorate-General for Regional Policy. 2011, Brussels, Belgium: European Commission Directorate-General for Regional Policy

Robinson AH: Elements of Cartography. 1995, New York: Wiley, 6

European Centre for Disease Prevention and Control: Development of Aedes Albopictus Risk Maps. Technical Report. 2009, Stockholm: European Centre for Disease Prevention and Control

Benedict MQ, Levine RS, Hawley WA, Lounibos LP: Spread of the tiger: global risk of invasion by the mosquito Aedes albopictus. Vector Borne Zoonotic Dis. 2007, 7: 76-85. 10.1089/vbz.2006.0562.

Eritja R, Escosa R, Lucientes J, Marques E, Molina R, Roiz D, Ruiz S: Worldwide invasion of vector mosquitoes: present European distribution and challenges for Spain. Biol Invasions. 2005, 7: 87-97. 10.1007/s10530-004-9637-6.

Fischer D, Thomas SM, Niemitz F, Reineking B, Beierkuhnlein C: Projection of climatic suitability for Aedes albopictus Skuse (Culicidae) in Europe under climate change conditions. Glob Planet Chang. 2011, 78: 54-64. 10.1016/j.gloplacha.2011.05.008.

Knudsen AB, Romi R, Majori G: Occurrence and spread in Italy of Aedes albopictus, with implications for its introduction into other parts of Europe. J Am Mosq Control Assoc. 1996, 12: 177-183.

Rogers DJ, Suk JE, Semenza JC: Using global maps to predict the risk of dengue in Europe. Acta Trop. 2014, 129: 1-14.

Hales S, Weinstein P, Woodward A: Dengue fever epidemics in the South Pacific: driven by El Nino Southern Oscillation?. Lancet. 1996, 348: 1664-1665.

Bouzid M, Hooper L, Hunter PR: The effectiveness of public health interventions to reduce the health impact of climate change: a systematic review of systematic reviews. PLoS One. 2013, 8: e62041-10.1371/journal.pone.0062041.

Sousa CA, Clairouin M, Seixas G, Viveiros B, Novo MT, Silva AC, Escoval MT, Economopoulou A: Ongoing outbreak of dengue type 1 in the Autonomous Region of Madeira, Portugal: preliminary report. Euro Surveill. 2012, 17: pii=20333-

Randolph SE, Rogers DJ: The arrival, establishment and spread of exotic diseases: patterns and predictions. Nat Rev Microbiol. 2010, 8: 361-371. 10.1038/nrmicro2336.

Murrell S, Wu SC, Butler M: Review of dengue virus and the development of a vaccine. Biotechnol Adv. 2011, 29: 239-247. 10.1016/j.biotechadv.2010.11.008.

Reiter P, Lathrop S, Bunning M, Biggerstaff B, Singer D, Tiwari T, Baber L, Amador M, Thirion J, Hayes J, Seca C, Mendez J, Ramirez B, Robinson J, Rawlings J, Vorndam V, Waterman S, Gubler D, Clark G, Hayes E: Texas lifestyle limits transmission of dengue virus. Emerg Infect Dis. 2003, 9: 86-89. 10.3201/eid0901.020220.

Angelini R, Finarelli AC, Angelini P, Po C, Petropulacos K, Macini P, Fiorentini C, Fortuna C, Venturi G, Romi R, Majori G, Nicoletti L, Rezza G, Cassone A: An outbreak of chikungunya fever in the province of Ravenna, Italy. Euro Surveill. 2007, 12: E070906 070901-

Rezza G, Nicoletti L, Angelini R, Romi R, Finarelli AC, Panning M, Cordioli P, Fortuna C, Boros S, Magurano F, Silvi G, Angelini P, Dottori M, Ciufolini MG, Majori GC, Cassone A: Infection with chikungunya virus in Italy: an outbreak in a temperate region. Lancet. 2007, 370: 1840-1846. 10.1016/S0140-6736(07)61779-6.

Clark DV, Mammen MP, Nisalak A, Puthimethee V, Endy TP: Economic impact of dengue fever/dengue hemorrhagic fever in Thailand at the family and population levels. Am J Trop Med Hyg. 2005, 72: 786-791.

PubMed   Google Scholar  

Naish S, Dale P, Mackenzie JS, McBride J, Mengersen K, Tong SL: Climate change and dengue: a critical and systematic review of quantitative modelling approaches. BMC Infect Dis. 2014, 14: 167-10.1186/1471-2334-14-167.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2458/14/781/prepub

Download references

Acknowledgments

This work was partially supported by the European Union under the RESPONSES project (Grant Agreement number 244092). Professor Hunter and Dr. Lake are part funded by The National Institute for Health Research Health Protection Research Unit in Emergency Preparedness and Response at King’s College London. FJCG was supported by the Mexican National Council of Science and Technology (CONACYT).

Author information

Tobias Lung

Present address: European Environment Agency, Copenhagen, Denmark

Authors and Affiliations

Norwich Medical School, University of East Anglia, Norwich, UK

Maha Bouzid & Paul R Hunter

School of Environmental Sciences, University of East Anglia, Norwich, UK

Felipe J Colón-González & Iain R Lake

The Abdus Salam International Centre for Theoretical Physics, Earth System Physics Section, Trieste, Italy

Felipe J Colón-González

Joint Research Centre, European Commission, Institute for Environment and Sustainability, Ispra, Italy

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Maha Bouzid .

Additional information

Competing interests.

The authors declare that they have no competing interests.

Authors’ contributions

MB and PRH designed the study and performed data analysis and interpretation. FJCC provided Mexican data and undertook the modelling. TL provided European data and performed geographical mapping of the model results. IRL was involved with modelling and results interpretation. All authors read and approved the final manuscript.

Electronic supplementary material

12889_2014_6968_moesm1_esm.png.

Additional file 1: Maps of Gross domestic product (GDP) of 2006 at NUTS-3 level calculated from Word Bank and EUROSTAT data (Left), and degree of urbanisation as derived from the EFGS GEOSTAT 2006 population grid dataset (right).(PNG 2 MB)

12889_2014_6968_MOESM2_ESM.png

Additional file 2: Range of Tmin and humidity, the two weather variables most significantly associated with dengue risk, in Mexico and Europe.(PNG 77 KB)

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2, authors’ original file for figure 3, authors’ original file for figure 4, rights and permissions.

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/4.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Cite this article.

Bouzid, M., Colón-González, F.J., Lung, T. et al. Climate change and the emergence of vector-borne diseases in Europe: case study of dengue fever. BMC Public Health 14 , 781 (2014). https://doi.org/10.1186/1471-2458-14-781

Download citation

Received : 02 April 2014

Accepted : 24 July 2014

Published : 22 August 2014

DOI : https://doi.org/10.1186/1471-2458-14-781

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Dengue fever
• Climate change
• Disease risk

BMC Public Health

ISSN: 1471-2458

• General enquiries: [email protected]

Warning: The NCBI web site requires JavaScript to function. more...

An official website of the United States government

The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• Browse Titles

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.

StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2024 Jan-.

StatPearls [Internet].

Dengue fever.

Timothy J. Schaefer ; Prasan K. Panda ; Robert W. Wolford .

Affiliations

Last Update: March 6, 2024 .

• Continuing Education Activity

Dengue is a mosquito-transmitted virus, and dengue fever is the leading cause of arthropod-borne viral disease worldwide, posing a significant global health concern. This disease is also known by various monikers, such as breakbone or 7-day fever, and is characterized by intense muscle spasms, joint pain, and high fever, reflecting both the severity and the duration of symptoms. Most dengue virus cases are asymptomatic, yet severe illness and mortality can occur, especially in regions where female  Aedes mosquitoes— Aedes aegypti and Aedes albopictus —primarily transmit the virus. Dengue fever, with over 100 million cases annually and 20 to 25,000 deaths, presents a substantial public health challenge, marked by epidemics across different regions globally. Diagnosis usually entails identifying virus antigens using diverse laboratory techniques. 

This activity explores the epidemiology of dengue fever, highlighting the increasing incidence observed in tropical and subtropical regions over recent decades, with some areas becoming endemic. This activity also analyzes the complexities of dengue hemorrhagic fever—a severe complication occurring in individuals previously infected with a dengue virus subspecies and subsequently infected with another. In addition, this activity aids clinicians in understanding the etiology, clinical presentation, diagnostic approaches, and management strategies for both dengue fever and dengue hemorrhagic fever, essential for effectively evaluating and addressing this global health threat and providing care to affected individuals.

• Identify the clinical manifestations and symptoms of dengue fever.
• Screen patients for dengue fever based on presenting symptoms, travel history, and exposure risk.
• Apply evidence-based treatment protocols for managing dengue fever, including fluid repletion and symptom management.
• Collaborate with interprofessional healthcare providers, including infectious disease specialists and public health authorities, to manage dengue virus outbreaks and improve patient outcomes.
• Introduction

Dengue is a mosquito-transmitted virus and is the leading cause of arthropod-borne viral disease worldwide, posing a significant global health concern. This disease is also known by various monikers, such as breakbone or 7-day fever, and is characterized by intense muscle spasms, joint pain, and high fever, reflecting both the severity and the duration of symptoms. Although most dengue fever cases are asymptomatic, severe illness and mortality can occur.  Aedes mosquitoes, primarily including the female vectors Aedes aegypti and A albopictus , transmit the virus and are common in tropical and subtropical parts of the world.

The incidence of dengue fever has increased dramatically over the past few decades, and the infection is now endemic in some parts of the world, possibly due to increased global travel. Dengue fever poses a significant public health challenge, with over 100 million cases annually and 20 to 25,000 deaths, marked by epidemics across different regions globally. After infection with a subspecies known as dengue hemorrhagic fever (DHF), some individuals previously infected with one subspecies of the dengue virus (DENV) develop severe capillary permeability and bleeding. [1] [2] [3]  Although the symptoms and signs overlap with several viral prodromes, the identifying features are discussed in the next sections.

Dengue fever is caused by any of the 4 distinct serotypes (DENV-1 to DENV-4) of single-stranded RNA viruses belonging to the genus Flavivirus . Infection by one serotype confers lifelong immunity to that serotype but not to others. [4] [5] [6]

• Epidemiology

Dengue fever is the fastest-spreading mosquito-borne viral disease worldwide, affecting over 100 million people annually. This disease also leads to 20 to 25,000 deaths, primarily among children, and is prevalent in more than 100 countries. Epidemics occur yearly in the Americas, Asia, Africa, and Australia.

The dengue virus is maintained by the following 2 transmission cycles:

• Mosquitoes carry the virus from a nonhuman primate to another nonhuman primate
• Mosquitoes transmit the virus from human to human

The human-mosquito cycle primarily occurs in urban environments. Whether the virus transmits from affected humans to mosquitoes depends on the viral load of the mosquitoes' blood meal. The primary vectors of the disease are female mosquitoes of the species Aedes aegypti and Aedes albopictus . Although A aegypti is associated with most infections, the geographic range of A albopictus is expanding. A albopictus , being more cold-tolerant, exhibits aggressive feeding behavior but does so less frequently, which may contribute to its increasing numbers. These mosquito species typically inhabit indoor environments and are active during the day. Modes of transmission include perinatal transmission, blood transfusions, breast milk, and organ transplantation. 

Between 1990 and 2010, the mean age of patients was 27.2, which has increased to 34 since 2010. The dengue viral serotype causing disease outbreaks has varied over time, along with the occurrence of severe dengue fever. [7] [8] Transmission of the dengue virus generally follows 2 patterns—epidemic dengue and hyperendemic dengue.

Epidemic dengue occurs when a single strain of dengue virus (DENV) is responsible for introduction and transmission, and such epidemics were more common before World War II. During epidemics, all age groups are affected, but the incidence of DHF is relatively low. Hyperendemicity, on the other hand, refers to the co-circulation of various serotypes of DENV in a community linked to periodic outbreaks. [9] In hyperendemic areas, children are affected more than adults, and the incidence of DHF is relatively higher.

• Pathophysiology

Belonging to the Flaviviridae family, the dengue virus is a 50-nm virion comprising 3 structural and 7 nonstructural proteins, a lipid envelope, and a 10.7-kb-capped positive-sense single strand of RNA. Infections are asymptomatic in up to 75% of affected individuals. The disease spectrum ranges from self-limiting dengue fever to severe hemorrhage and shock. A fraction of infections, between 0.5% and 5%, develop into severe dengue. Without proper treatment, fatality rates may exceed 20%, particularly among children. The typical incubation period for the disease is 4 to 7 days, with symptoms lasting from 3 to 10 days. Symptoms appearing more than 2 weeks after exposure are unlikely to be attributed to dengue fever. 

The consequences of a mosquito bite injecting the dengue virus into the skin remain unclear. Skin macrophages and dendritic cells are believed to be the initial targets. These infected cells are thought to migrate to the lymph nodes and disseminate through the lymphatic system to other organs. Viremia, the presence of the virus in the bloodstream, may occur for 24 to 48 hours before the onset of symptoms.

The presentation of dengue fever, whether asymptomatic, typical, or severe, is influenced by a complex interplay of host and viral factors. Severe dengue fever, characterized by heightened microvascular permeability and shock syndrome, is often associated with infection by a second dengue virus serotype and the patient's immune response. However, severe cases of dengue fever can also arise from infection by a single serotype. Interestingly, microvascular permeability tends to escalate as viral titers decrease.

• History and Physical

The 3 phases of dengue fever include febrile, critical, and recovery stages (see Image. Primary Symptoms of Dengue Fever).

The febrile phase:  During the febrile phase, individuals typically experience a sudden onset of high-grade fever, reaching approximately 40 °C, which usually lasts for 2 to 7 days. Approximately 6% of cases may exhibit saddleback or biphasic fever, particularly in patients with DHF and severe dengue fever. The fever usually persists for at least 24 hours, followed by a subsequent spike lasting at least 1 more day. [10] Associated symptoms during this phase include facial flushing, skin erythema, myalgias, arthralgias, headache, sore throat, conjunctival injection, anorexia, nausea, and vomiting. Skin erythema manifests as a general blanchable macular rash within 1 to 2 days of fever onset and again on the last day. Alternatively, within 24 hours, a secondary maculopapular rash may develop.

The critical phase:  During the critical phase, defervescence marks a period when the temperature typically decreases to approximately 37.5 to 38 °C or lower, occurring between days 3 and 7. This phase is associated with heightened capillary permeability and typically lasts for 1 to 2 days. Before the critical phase, there is often a rapid decline in platelet count, accompanied by increased hematocrit levels. Leukopenia may also occur up to 24 hours before the platelet count drops and warning signs emerge. If left untreated, the critical phase can progress to shock, organ dysfunction, disseminated intravascular coagulation, or hemorrhage.

The recovery phase: The recovery phase involves the gradual reabsorption of extravascular fluid over 2 to 3 days. During this period, patients often exhibit bradycardia.

Expanded dengue virus syndrome refers to unusual or atypical manifestations seen in patients with involvement of various organs such as neurological, hepatic, and renal. This syndrome can be associated with profound shock. Neurological manifestations may include febrile seizures in young children, encephalitis, aseptic meningitis, and intracranial bleeding. Gastrointestinal involvement might present as hepatitis, liver failure, pancreatitis, or acalculous cholecystitis. In addition, this syndrome can manifest as myocarditis, pericarditis, acute respiratory distress syndrome, acute kidney injury, or hemolytic uremic syndrome.

Common laboratory findings include thrombocytopenia, leukopenia, and elevated levels of aspartate aminotransferase. The disease is classified as either dengue or severe dengue. [11] [12] [13]

• Probable dengue: The patient lives in or has traveled to a Dengue-endemic area. Symptoms include fever and 2 of the following: nausea, vomiting, rash, myalgias, arthralgias, rash, positive tourniquet test, or leukopenia.
• Warning signs of dengue:  Dengue symptoms include abdominal pain, persistent vomiting, clinical fluid accumulation such as ascites or pleural effusion, mucosal bleeding, lethargy, liver enlargement greater than 2 cm, increase in hematocrit, and thrombocytopenia.
• Severe dengue:  Severe dengue is characterized by dengue fever accompanied by severe plasma leakage, hemorrhage, impaired consciousness, myocardial dysfunction, pulmonary dysfunction, and organ dysfunction, including transaminitis greater than 1000 IU/L.
• Dengue shock syndrome clinical warnings: Symptoms include rapidly rising hematocrit, intense abdominal pain, persistent vomiting, and narrowed or absent blood pressure.

The virus antigen can be detected using enzyme-linked immunosorbent assay (ELISA) test, polymerase chain reaction (PCR), or by isolating the virus from body fluids. Serology typically shows a significant increase in immunoglobulins. A confirmed diagnosis is established through culture, antigen detection, PCR, or serologic testing. Notably, it is crucial to evaluate pregnant patients with dengue carefully, as the symptoms can resemble those of preeclampsia.

• Treatment / Management

The treatment approach for dengue fever varies depending on the patient's illness phase. Patients without warning signs can typically be treated as outpatients with acetaminophen and sufficient oral fluids. In addition, educating patients about the warning signs and advising them to seek immediate medical attention if any of these signs occur is important.

Patients presenting with warning signs of the disease, severe dengue fever, or having risk factors such as age, pregnancy status, diabetes mellitus, or those who are living alone should be evaluated for hospitalization. Individuals displaying warning signs can be started on intravenous (IV) crystalloids, with the fluid rate adjusted based on the patient's response. Patients in shock and not responding to initial crystalloid boluses may require colloids.

Blood transfusion is indicated in cases of severe or suspected bleeding when the patient remains unstable despite adequate fluid resuscitation and hematocrit falls. Platelet transfusion may be necessary if the platelet count drops below 20,000 cells per microliter and there is a high risk of bleeding. Notably, it is essential to avoid administering aspirin, nonsteroidal anti-inflammatory drugs (NSAIDs), and other anticoagulants. No antiviral medications are recommended, and no laboratory tests can reliably predict the progression to severe disease.

• Differential Diagnosis

The clinical diagnosis of dengue fever can be challenging as many other illnesses can present similarly early in the disease course. Other differential diagnoses include measles, influenza, and mosquito-vector diseases such as Zika virus disease, West Nile infection, chikungunya, malaria, and yellow fever (see Image. Mosquito-Borne Diseases).

Obtaining a detailed history of immunizations, travel, and exposures is crucial for the diagnosis of dengue fever. Rapid laboratory identification of the dengue virus involves NS1 antigen detection and serological tests. Serological tests are only helpful after several days of infection and may yield false positives due to other Flavivirus infections, such as yellow fever or Zika virus.

Untreated severe dengue fever may have a mortality rate of 10% to 20%. However, with appropriate supportive care, the mortality rate can be reduced to approximately 1%.

• Complications

Complications of dengue fever may include liver injury, cardiomyopathy, pneumonia, orchitis, oophoritis, seizures, encephalopathy, and encephalitis.

• Postoperative and Rehabilitation Care

Patients should be encouraged to drink plenty of fluids. The return of appetite in a patient is a sign that the infection is subsiding.

• Consultations

Consulting an infectious disease specialist is recommended, as many clinicians have limited experience managing this infection. The Centers for Disease Control and Prevention (CDC) also provides a hotline offering treatment advice.

• Deterrence and Patient Education

The only way to avoid contracting dengue virus is to prevent mosquito bites and avoid endemic areas.

Preventative Measures

• Using bed nets from daytime onward.
• Utilizing insecticide-treated materials such as window curtains.
• Applying mosquito-repellant creams containing DEET, IR3535, or icaridin.
• Using mosquito-repellant coils.
• Developing the habit of wearing long-sleeved shirts and pants. [14]

Biological Control

• Fish: Introducing viviparous species of fish, such as Poecilia reticulata , into confined water bodies such as large water tanks or open freshwater wells, and utilizing native larvicidal fish.
• Predatory copepods: Implementing small freshwater crustaceans as effective predators, particularly in specific container habitats.
• Endosymbiotic control: Utilizing mosquitoes infected with Wolbachia, an intracellular parasite, as they demonstrate reduced susceptibility to DENV infection compared to wild-type mosquitoes  A aegypti . [15]

Chemical Control 

• Using larvicidal in big breeding containers.
• Applying insecticide sprays via space sprays, which can be administered as thermal fogs or cold aerosols.
• Using oil-based formulations, as they inhibit evaporation
• Using a few common insecticides such as organophosphorus compounds (fenitrothion and malathion) and pyrethroids (bioresmethrin and cypermethrin).

Environmental Measures

• Identifying and eliminating the breeding areas of mosquitoes and pests.
• Maintaining the rooftops and sunshades properly.
• Covering stored water in buckets, pots, and other vessels appropriately.

Health Education

Educating individuals about the dengue virus is crucial for effective public health interventions. Utilizing audiovisual and mass awareness campaigns can serve as initial steps in disseminating knowledge about the virus, which can be implemented at both individual and population levels. 

Vaccination

CYD-TDV, the first licensed live recombinant tetravalent dengue vaccine, is approved for use in endemic areas across 20 countries. [16]

• Enhancing Healthcare Team Outcomes

Diagnosing and managing dengue fever involve a multidisciplinary team of healthcare professionals comprising an infectious disease expert, a CDC consultant, an emergency department clinician, and an internist. Treatment primarily focuses on supportive care, including fluid repletion, acetaminophen for fever management, and blood transfusion if hemorrhage occurs. A confirmed diagnosis is established through various methods such as culture, antigen detection, polymerase chain reaction, or serologic testing.

Laboratory tests cannot reliably predict the progression to severe disease. Primary care clinicians and nurse practitioners play a crucial role in educating travelers on preventing mosquito bites and adopting preventive measures such as covering their exposed skin, using bed nets, mosquito repellents, and indoor insecticides, as well as eliminating mosquito breeding grounds such as standing water. While the prognosis for untreated dengue fever is poor, most patients can survive with supportive care, although some may experience residual multisystem organ damage. [17] [18]

• Review Questions
• Access free multiple choice questions on this topic.
• Comment on this article.

Primary Symptoms of Dengue Fever. The symptoms of dengue fever are multisystemic and encompass 3 distinct phases: febrile, critical, and recovery. Mikael Häggström, Public Domain, via Wikimedia Commons.

Mosquito-Borne Diseases. Mosquitoes are carriers of various diseases, including Zika, dengue fever, West Nile fever, chikungunya, yellow fever, and malaria. National Institute of Allergy and Infectious Diseases, National Institutes of Health

Disclosure: Timothy Schaefer declares no relevant financial relationships with ineligible companies.

Disclosure: Prasan Panda declares no relevant financial relationships with ineligible companies.

Disclosure: Robert Wolford declares no relevant financial relationships with ineligible companies.

This book is distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) ( http://creativecommons.org/licenses/by-nc-nd/4.0/ ), which permits others to distribute the work, provided that the article is not altered or used commercially. You are not required to obtain permission to distribute this article, provided that you credit the author and journal.

• Cite this Page Schaefer TJ, Panda PK, Wolford RW. Dengue Fever. [Updated 2024 Mar 6]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2024 Jan-.

In this Page

Bulk download.

• Bulk download StatPearls data from FTP

Related information

• PMC PubMed Central citations
• PubMed Links to PubMed

Similar articles in PubMed

• Review Dengue virus: A global human threat: Review of literature. [J Int Soc Prev Community Dent....] Review Dengue virus: A global human threat: Review of literature. Hasan S, Jamdar SF, Alalowi M, Al Ageel Al Beaiji SM. J Int Soc Prev Community Dent. 2016 Jan-Feb; 6(1):1-6.
• [Dengue fever--not just a tropical infectious disease]. [Med Monatsschr Pharm. 2016] [Dengue fever--not just a tropical infectious disease]. Stock I. Med Monatsschr Pharm. 2016 Mar; 39(3):117-22.
• Infection of Mosquito Cells (C6/36) by Dengue-2 Virus Interferes with Subsequent Infection by Yellow Fever Virus. [Vector Borne Zoonotic Dis. 2016] Infection of Mosquito Cells (C6/36) by Dengue-2 Virus Interferes with Subsequent Infection by Yellow Fever Virus. Abrao EP, da Fonseca BA. Vector Borne Zoonotic Dis. 2016 Feb; 16(2):124-30. Epub 2016 Jan 25.
• Review Value of routine dengue diagnosis in endemic countries. [World J Virol. 2017] Review Value of routine dengue diagnosis in endemic countries. Ayukekbong JA, Oyero OG, Nnukwu SE, Mesumbe HN, Fobisong CN. World J Virol. 2017 Feb 12; 6(1):9-16.
• A rare presentation of dengue fever: bilateral psoas muscle hematoma, intrahepatic cholestatic hepatitis, pancreatitis and pancytopenia. [Oxf Med Case Reports. 2023] A rare presentation of dengue fever: bilateral psoas muscle hematoma, intrahepatic cholestatic hepatitis, pancreatitis and pancytopenia. Islam J, Mondal K, Ghosh SK, Datta AK, Ghosh S. Oxf Med Case Reports. 2023 Oct; 2023(10):omad115. Epub 2023 Oct 23.

Recent Activity

• Dengue Fever - StatPearls Dengue Fever - StatPearls

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Connect with NLM

National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894

Web Policies FOIA HHS Vulnerability Disclosure

Help Accessibility Careers

Last updated 20/06/24: Online ordering is currently unavailable due to technical issues. We apologise for any delays responding to customers while we resolve this. For further updates please visit our website: https://www.cambridge.org/news-and-insights/technical-incident

We use cookies to distinguish you from other users and to provide you with a better experience on our websites. Close this message to accept cookies or find out how to manage your cookie settings .

Login Alert

• > Case Studies in Pediatric Critical Care
• > Child with dengue hemorrhagic fever

Book contents

• Case Studies in Pediatric Critical Care
• Copyright page
• Contributors
• Chapter 1 Respiratory syncytial virus bronchiolitis
• Chapter 2 The infant with meningococcal septicemia
• Chapter 3 A 2-year-old child with acute bacterial meningitis
• Chapter 4 Management of a neonate with hypoplastic left heart syndrome
• Chapter 5 Child with a head injury
• Chapter 6 Management of diabetic ketoacidosis in a child
• Chapter 7 Tricyclic antidepressant poisoning in children
• Chapter 8 Management of hemolytic uremic syndrome
• Chapter 9 Management of severe acute asthma in children
• Chapter 10 The neonate with total anomalous pulmonary venous connection
• Chapter 11 Critical care for a child with 80% burns
• Chapter 12 Coarctation of the aorta in a neonate
• Chapter 13 The 2-month-old with severe pertussis (whooping cough)
• Chapter 14 Pericardial effusion in a child
• Chapter 15 Management of non-accidental injury on the Pediatric Intensive Care Unit
• Chapter 16 Management of a 3-year-old child with drowning
• Chapter 17 Child with dengue hemorrhagic fever
• Chapter 18 The child with HIV infection
• Chapter 19 Refractory narrow complex tachycardia in infancy
• Chapter 20 The neonate with hyperammonemia
• Chapter 21 Management of acute heart failure in pediatric intensive care
• Chapter 22 Tetralogy of Fallot
• Chapter 23 The child with thermal injury and smoke inhalation
• Chapter 24 A child with multiple trauma
• Chapter 25 Management of the patient with a failing fontan – morbidities of a palliative procedure
• Chapter 26 Sepsis in a BMT patient admitted to PICU
• Chapter 27 Management of sagittal sinus thrombosis in a child

Chapter 17 - Child with dengue hemorrhagic fever

Published online by Cambridge University Press:  23 December 2009

Access options

Save book to kindle.

To save this book to your Kindle, first ensure [email protected] is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about saving to your Kindle .

Note you can select to save to either the @free.kindle.com or @kindle.com variations. ‘@free.kindle.com’ emails are free but can only be saved to your device when it is connected to wi-fi. ‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service .

• Child with dengue hemorrhagic fever
• By Adrian Y. Goh
• Edited by Peter J. Murphy , Stephen C. Marriage , Peter J. Davis
• Book: Case Studies in Pediatric Critical Care
• Online publication: 23 December 2009
• Chapter DOI: https://doi.org/10.1017/CBO9780511581656.018

Save book to Dropbox

To save content items to your account, please confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your account. Find out more about saving content to Dropbox .

Save book to Google Drive

To save content items to your account, please confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your account. Find out more about saving content to Google Drive .

Disclaimer » Advertising

• HealthyChildren.org

• Previous Article
• Next Article

A Growing Problem in the United States

Environmental factors contributing to dengue as a public health threat, pathogenesis, clinical considerations, presentation and evaluation, diagnostic testing for symptomatic denv infection, traditional prevention measures, novel vector control efforts, current dengue vaccines, principles of live-attenuated dengue vaccines, history of dengvaxia, safety and efficacy, prevaccination laboratory testing, conclusion and future directions, acknowledgment, dengue: a growing problem with new interventions.

• Split-Screen
• Article contents
• Figures & tables
• Supplementary Data
• Peer Review
• CME Quiz Close Quiz
• Open the PDF for in another window
• Get Permissions
• Cite Icon Cite
• Search Site

Joshua M. Wong , Laura E. Adams , Anna P. Durbin , Jorge L. Muñoz-Jordán , Katherine A. Poehling , Liliana M. Sánchez-González , Hannah R. Volkman , Gabriela Paz-Bailey; Dengue: A Growing Problem With New Interventions. Pediatrics June 2022; 149 (6): e2021055522. 10.1542/peds.2021-055522

Download citation file:

• Ris (Zotero)
• Reference Manager

Dengue is the disease caused by 1 of 4 distinct, but closely related dengue viruses (DENV-1–4) that are transmitted by Aedes spp. mosquito vectors. It is the most common arboviral disease worldwide, with the greatest burden in tropical and sub-tropical regions. In the absence of effective prevention and control measures, dengue is projected to increase in both disease burden and geographic range. Given its increasing importance as an etiology of fever in the returning traveler or the possibility of local transmission in regions in the United States with competent vectors, as well as the risk for large outbreaks in endemic US territories and associated states, clinicians should understand its clinical presentation and be familiar with appropriate testing, triage, and management of patients with dengue. Control and prevention efforts reached a milestone in June 2021 when the Advisory Committee on Immunization Practices (ACIP) recommended Dengvaxia for routine use in children aged 9 to 16 years living in endemic areas with laboratory confirmation of previous dengue virus infection. Dengvaxia is the first vaccine against dengue to be recommended for use in the United States and one of the first to require laboratory testing of potential recipients to be eligible for vaccination. In this review, we outline dengue pathogenesis, epidemiology, and key clinical features for front-line clinicians evaluating patients presenting with dengue. We also provide a summary of Dengvaxia efficacy, safety, and considerations for use as well as an overview of other potential new tools to control and prevent the growing threat of dengue.

Dengue is the disease caused by 4 closely related but distinct viruses, dengue virus 1–4 (DENV-1–4), referred to as virus types or serotypes. DENVs are most commonly transmitted by the bite of an infected female Aedes spp. mosquito. It is the most common arboviral disease globally, with an estimated 390 million dengue virus infections and 96 million symptomatic cases annually. 1   Global incidence has almost doubled in the last 3 decades and is expected to continue growing in Asia, sub-Saharan Africa, and Latin America. About half of the global population now lives in areas that are suitable for dengue transmission ( Fig 1 ). 2 , 3   Historically, the highest burden of dengue has been in children, adolescents, and young adults. 4   In 2019, countries across the Americas reported more than 3 million dengue cases, the highest number ever recorded, 5   with a greater proportion of severe dengue cases and increased mortality in the pediatric population of children aged 5 to 9 years. 6   Dengue is increasingly common as an etiology of fever in international travelers 7   and has been reported as the leading febrile disease etiology for travelers from some endemic regions during epidemic years. 8   In addition to circulation of all four DENVs worldwide, surveillance of returning travelers with dengue has demonstrated high genetic diversity among circulating DENV genotypes within serotypes, with potential implications for immune or vaccine escape. 9 , 10  

Map showing the risk of dengue by country as of 2020. “Frequent or Continuous” risk indicates that there are either frequent outbreaks or ongoing transmission. “Sporadic or Uncertain” indicates that risk is either variable and unpredictable or that data from that country are not available. For updated information, visit https://www.cdc.gov/dengue/areaswithrisk/around-the-world.html .

Increasing numbers of dengue cases in the United States are a growing concern. In parts of the United States and freely associated states with endemic dengue transmission, including American Samoa, Puerto Rico, US Virgin Islands, Federated States of Micronesia, Republic of Marshall Islands, and the Republic of Palau, dengue outbreaks can be explosive, overwhelming the health care system capacity. In Puerto Rico, the largest US territory where dengue is endemic, the highest incidence of dengue cases and hospitalizations from 2010 to 2020 occurred among children aged 10 to 19 years. 11   For the same period, confirmed dengue cases ranged from a minimum of 3 cases in 2018 to a maximum of 10 911 cases in 2010, 11   although suspected case counts during outbreak years were considerably higher. 12  

Although local dengue transmission does not occur frequently in most states, increasing numbers of US travelers 13   with dengue have been reported in recent years, with a record 1475 cases in 2019, more than 50% higher than the previous peak in 2016 ( Fig 2 ). 14   Viremia among travel-associated dengue cases can also result in focal outbreaks in nonendemic areas, with competent mosquito vectors for dengue present in approximately half of all US counties. 15   Local dengue cases have been reported in multiple states in recent years, including 70 cases in Florida in 2020, 14   200 cases in Hawaii in 2015, 14   and 53 cases in Texas in 2013. 16  

Annual number of travel-associated cases of dengue reported into ArboNET, the national arboviral surveillance system managed by the CDC, from all US jurisdictions from 2010 to 2019 ( n = 6967).

In dengue-endemic areas, environmental factors such as standing water where mosquitoes lay eggs, poor housing quality, lack of air conditioning, and climatic factors (ie, temperature, precipitation, and humidity) increase the abundance, distribution, and risk of exposure to Aedes aegypti , the main vector responsible for dengue transmission, or other Aedes spp. mosquitoes that can also transmit dengue. 2 , 17 – 21   Climate change is predicted to further increase the population at risk for dengue primarily through increased transmission in currently endemic areas and secondarily through expansion of the geographic range of Aedes spp. mosquitoes ( Fig 3 ). 2 , 22   Urbanization, increasing population density, human migration, and growing social and environmental factors associated with poverty and forced displacement are also expected to drive the increase in dengue incidence and force of infection globally. 21 , 23 – 26   Travel is an important driver of dengue expansion by introducing dengue into nonendemic areas with competent vectors 13 , 23   or by introducing new serotypes into endemic areas naïve to the new serotype, thereby increasing the risk for antibody-dependent enhancement (ADE) and severe disease. 27 , 28   Combined environmental effects of poverty and the increased scale and rapidity of human movement can also increase the risk for dengue. 24 , 29   The combined environmental effects of climate change, urbanization, poverty, and human migration together expand the threat of dengue for both individuals and public health systems in the future.

A-C, Projections of average trends in environmental suitability for dengue transmission from 2015 to 2020, 2020 to 2050, and 2050 to 2080. D–F, Areas with expansion or contraction of the Aedes vector range over the same time periods. (Reprinted with permission from Messina JP, Brady OJ, Golding N, Kraemer MUG, Wint GRW, Ray SE, et al. The current and future global distribution and population at risk of dengue. Nature Microbiology. 2019;4(9):1510.)

DENVs belong to the genus Flavivirus in the family Flaviviridae . Because there are 4 dengue serotypes, individuals living in endemic areas can be infected up to 4 times in their life. Although most dengue virus infections are asymptomatic or only cause mild disease, severe disease can occur and is characterized by plasma leakage, a pathophysiologic process by which the protein rich fluid component of blood leaks into the surrounding tissue, leading to extravascular fluid accumulation resulting in shock, coagulopathy, or end organ impairment. 30 , 31  

Infection with 1 dengue serotype induces life-long protection against symptomatic infection with that specific serotype (homotypic immunity) 32 , 33   and induces only short-term cross-reactive protection from disease to the other serotypes (heterotypic immunity) for several months to years. 34 , 35   Older children and adults experiencing their second dengue infection are at the highest risk for severe disease because of ADE. ADE has also been observed among infants, in that infants born to mothers with previous dengue virus infection had the lowest risk for dengue shortly after birth and a period of higher risk for severe disease approximately 4 to 12 months after birth, followed by a decrease in risk for severe disease from approximately 12 months after birth. 36   The initial period of lowest risk was correlated with high levels of passively acquired maternal dengue antibodies immediately after birth, and the period of enhanced risk with a decline in these antibodies to subneutralizing levels. After further degradation of these maternal antibodies, there was neither protection from dengue afforded by high levels of antibodies postnatally nor enhanced risk of dengue and severe disease from the intermediate levels of antibodies. 37   Later work showed that lower heterotypic antibody titers are ineffective at neutralizing the virions but still bind them, facilitating binding to Fcγ receptors on circulating monocyte cells, and result in higher viremia than in primary infections ( Fig 4 ). 38   The feared sequela of plasma leakage is believed to be mediated by high levels of DENV nonstructural protein 1 (NS1), a key protein for viral replication and pathogenesis, 39 , 40   that damages endothelial glycocalyces and disrupts endothelial cell junctions. 41 , 42   Cell-mediated immunity through dengue-specific CD8 T cells is thought to protect against ADE and severe disease. 43 , 44  

The proposed mechanism of antibody-dependent enhancement with heterotypic antibodies binding to the dengue viruses and entering monocytes through Fcγ receptors. Viral replication occurs in the infected monocyte and releases high levels of virus and dengue virus NS1 protein, which, in turn, lead to increased vascular permeability contributing to severe disease. (Reprinted with permission from Whitehead SS, Blaney JE, Durbin AP, Murphy BR. Prospects for a dengue virus vaccine. Nature Reviews Microbiology. 2007;5(7):524.)

Although ADE occurs in infants due to the interaction between maternal antibodies and primary infection, it is also explanatory for severe disease in older children and adults where the heterotypic antibodies produced after a primary dengue infection will wane over time to subneutralizing levels, resulting in the highest risk for severe disease with secondary infection. Following secondary infection, potent cross-neutralizing/multitypic antibodies are induced that then protect against severe disease in tertiary and quaternary infections. 45 , 46   Although the risk of severe dengue is highest with secondary infection, it can also occur in primary, tertiary, and quaternary infections, and possibly following Zika virus infection. 47 , 48   Identifying cases of severe dengue and understanding the pathogenesis of disease severity is an active area of research with important implications for future vaccines and interventions. 49  

DENV infections have a wide range of presentations from asymptomatic infection (approximately 75% of all infections 50   ) to mild to moderate febrile illness to severe disease with associated coagulopathy, shock, or end organ impairment ( Table 1 ). 30 , 31   Symptomatic infections most commonly present with fever accompanied by nonspecific symptoms such as nausea, vomiting, rash, myalgias, arthralgias, retroorbital pain, headache and/or leukopenia. 51   Severe disease develops in as many as 5% of all patients with dengue, although certain populations such as infants aged ≤1 year, pregnant individuals, and adults aged ≥65 years, or individuals with specific underlying conditions such as diabetes, class III obesity, hypertension, asthma, coagulopathy, gastritis or peptic ulcer disease, hemolytic disease, chronic liver disease, anticoagulant therapy, or kidney disease, are at increased risk of severe disease. 52 , 53   In all patients with dengue, warning signs are specific clinical findings that can predict progression to severe disease and are used by the World Health Organization (WHO) to help clinicians in triage and management decisions. Dengue warning signs include abdominal pain or tenderness, persistent vomiting, clinical fluid accumulation, mucosal bleeding, lethargy or restlessness, liver enlargement of >2 cm, and increasing hematocrit concurrent with rapid decrease in platelet count ( Table 1 ). 52  

Classification of Dengue Severity and Case Management 51 ,134, 135

Although warning signs are useful for evaluating patients with a high suspicion of dengue (for example, during an outbreak), they are not intended to differentiate dengue from other infectious and noninfectious diseases such as influenza, coronavirus disease 2019, malaria, Zika, measles, leptospirosis, rickettsial disease, typhoid, Kawasaki, or idiopathic thrombocytopenic purpura. Because prompt recognition and early treatment of dengue can greatly reduce morbidity and mortality, 54 , 55   clinicians practicing in the United States and other nonendemic areas should keep dengue in the differential diagnosis for febrile illness in travelers and in areas with competent mosquito vectors.

For symptomatic dengue patients, nucleic acid amplification tests (NAATs) on serum, plasma, or whole blood detect DENV RNA during the first 7 days of illness with high sensitivity and specificity. 56 , 57   Likewise, NS1 antigen can also be detected within the first 7 days and provides confirmatory evidence of DENV infection. 58   For patients with a negative NAAT or patients presenting more than 7 days after symptom onset, a positive anti-DENV immunoblobulin M (IgM) can suggest recent infection, although with less certainty than NAAT or NS1 testing, owing to cross-reactivity with other flaviviruses. Notably, Zika virus is a flavivirus that has been transmitted in most countries where DENV transmission is present. 59   In patients from areas with ongoing transmission of another flavivirus (eg, Zika virus) and whose only evidence of dengue is a positive anti-DENV IgM test, plaque reduction neutralization tests (PRNT) quantifying virus-specific neutralizing antibody titers can distinguish DENV from other flaviviruses, in some but not all cases. PRNTs, however, are rarely available in clinical laboratories and typically do not provide results within a timeframe that is meaningful for clinicians managing acute disease. PRNT’s may be valuable in circumstances where confirming the diagnosis may have important clinical implications, such as distinguishing dengue from a Zika virus infection in a pregnant individual, or epidemiologic implications for a region, such as distinguishing yellow fever from dengue. 60 , 61  

The US Food and Drug Administration (FDA) has approved a NAAT for use on serum and whole blood, an NS1 antigen enzyme-linked immunosorbent assay test in serum, and an IgM enzyme-linked immunosorbent assay in serum. 56 , 59 , 62 – 64   Other non–FDA-approved tests for DENV infection are used in clinical practice and are commercially available at accredited laboratories.

Although several medications have been explored as potential therapeutics for dengue, none have demonstrated a reduction in viremia, clinical manifestations, or complications. 30 , 65   As such, dengue treatment focuses on supportive care. Clinicians should evaluate all patients at presentation and in follow-up for warning signs or other signs and symptoms of severe dengue ( Table 1 ). Most patients without warning signs may be treated as outpatients, whereas patients at high risk of progression to severe disease based on age or underlying conditions, patients with warning signs, or patients with challenging social circumstances should be evaluated for observation or inpatient management. 66  

For outpatients, fever can be controlled with acetaminophen and physical cooling measures; because of the risk of bleeding and thrombocytopenia, aspirin and nonsteroidal anti-inflammatory drugs are not recommended. Early, abundant oral hydration has been associated with lower hospitalization rates in children with dengue and is a key component of outpatient dengue care. 67 – 69  

Early recognition of warning signs or severe dengue is essential for the prompt initiation of systematic intravenous fluid management to restore intravascular volume and avoid related complications and disease progression. 30 , 70   Large-volume resuscitation with isotonic solutions is recommended for patients in shock. 54 , 71 – 73   Fluid management in dengue requires continuous clinical and laboratory monitoring and rate adjustments to maintain adequate volume but also to prevent fluid overload. Mortality for untreated severe dengue can be 13% or higher 74 , 75   but can be reduced to <1% with early diagnosis and appropriate management. 55   Detailed information on systematic fluid management is provided in the current WHO, Pan American Health Organization, and Centers for Disease Control and Prevention (CDC) guidelines. 72 , 73 , 76  

Corticosteroids, 77   immunoglobulins, 78   and prophylactic platelet transfusions 79 , 80   have not demonstrated benefits in patients with dengue and are not recommended.

Prevention of dengue involves protection against mosquito bites. Travelers to and residents of endemic areas can prevent mosquito bites by using US Environmental Protection Agency–approved insect repellents ( https://www.epa.gov/insect-repellents ) and wearing clothing that covers arms and legs. The use of screened windows and doors, air conditioning, and bed nets has been associated with protection from dengue infections. 24 , 81 – 87   Sites where mosquitoes lay eggs should be eliminated by emptying and scrubbing, covering, or eliminating standing water receptacles around the house. Mosquito bite prevention measures are important for all persons at risk for dengue, including vaccinated children.

Traditional vector control interventions can be time consuming and inefficient. 88   Furthermore, chemical control is limited by widespread insecticide resistance in endemic areas. 89   In response to these challenges, novel vector control methods have been developed including several strategies employing genetically modified mosquito technology and 2 strategies using Wolbachia pipientis , an intracellular bacterium found in about 60% of all insects but not commonly found in wild Aedes mosquitos. 90 – 92  

The first strategy utilizing Wolbachia is Wolbachia -mediated suppression, in which a reduction in wild populations of Aedes mosquitoes is achieved by continuously releasing infected males into the environment. 93   When the infected males mate with wild females, the resultant eggs are inviable, leading to a decline in wild mosquito populations. 94   Some reports have documented reduction of the wild populations that can transmit dengue by more than 80%. 95 , 96  

The second strategy is the Wolbachia replacement method, where both Wolbachia -infected male and female mosquitoes are released. Because Wolbachia is transmitted maternally, the mosquitoes that hatch from the eggs of infected females will be infected with Wolbachia from birth. 97 , 98   Wolbachia infection in female mosquitoes taking a bloodmeal reduces transmission of arboviruses, including dengue, chikungunya, and Zika. This method has demonstrated significant reductions of nearly 80% for the outcomes of dengue infection and related hospitalizations in areas where it has been implemented 99   and is currently being deployed in several countries.

Extensive studies have found no evidence of Wolbachia in the plants, soil, or other insects in contact with the Wolbachia -infected mosquitoes or any evidence of Wolbachia transmission to humans from the bites of infected mosquitoes, indicating that safety risks from Wolbachia -based interventions for humans and the environment are low. 100  

ACIP made the first recommendation of a dengue vaccine (Dengvaxia) for use in the United States on June 24, 2021, marking an historic moment for dengue control following decades of global efforts to develop a safe and effective vaccine. Two other vaccines, TAK-003 developed by Takeda and TV003 developed by the National Institutes of Health, are in late-stage trials with efficacy results published or expected in 2022.

All 3 are live vaccines and contain 4 different attenuated vaccine viruses (tetravalent) targeting each of the dengue virus serotypes ( Fig 5 ) with the goal of achieving balanced protective immunity against all 4 serotypes, in both those who are DENV naïve and those who have been previously infected with DENV. Vaccine virus replication (infectivity) of each vaccine serotype after immunization will lead to antigenic stimulation, which then results in homotypic immunity. Infectivity by vaccine virus serotype differed among the 3 vaccines ( Table 2 ).

Key features of the 3 live attenuated dengue vaccines. Each DENV serotype is represented by a color (DENV-1 = green, DENV-2 = gray, DENV-3 = crimson, and DENV-4 = blue). Dengvaxia is comprised of 4 chimeric viruses in which the prM and E of each DENV serotype replaces those of yellow fever 17D (yellow). 132   TAK-003 is comprised of 1 full-length DENV-2 and 3 chimeric viruses (prM and E of DENV-1, DENV-3, and DENV-4 on a DENV-2 background). 133   TV003 is comprised of 3 full-length DENV and 1 chimeric virus. 123   The total number of dengue proteins in each vaccine is also shown.

Percentage of Vaccine Recipients with Detectable Vaccine Virus Serotype by RT-PCR after a Single Dose of the Indicated Vaccine in Persons without Previous Dengue Virus Infections

Data are presented as percentage.

These differences in vaccine serotype specific infectivity mirrored the induction of neutralizing homotypic antibody titers. Dengvaxia induced approximately 70% homotypic antibody for DENV-4 but <50% for DENV-1, DENV-2, and DENV-3. 101   Antibodies induced by TAK-003 were 83% homotypic for DENV-2 and 5%, 12%, and 27% homotypic for DENV-1, DENV-3, and DENV-4, respectively. 102   TV003 induced a balanced homotypic antibody response to DENV-1 (62%), DENV-2 (76%), DENV-3 (86%), and DENV-4 (100%). 103   Although homotypic antibody titers are associated with serotype specific vaccine efficacy, immune correlates that reliably predict vaccine efficacy have not yet been identified and remain an area of active research. 46  

Dengvaxia uses a 3-dose schedule with each dose given 6 months apart (at months 0, 6, and 12). It was developed by Washington and St Louis Universities and Acambis and licensed to Sanofi Pasteur in the 2000s, entered phase 3 trials in the 2010s, and was first recommended by WHO in 2016 for persons aged 9 years and older living in highly endemic areas. Long-term follow-up data (over 5 years) from the phase 3 trials and further analyses of the efficacy results 104 – 107   demonstrated that children with evidence of previous DENV infection were protected from virologically confirmed dengue illness, including severe dengue if they were vaccinated with Dengvaxia. However, risk of hospitalization for dengue and severe dengue was increased among children without previous dengue infection who were vaccinated with Dengvaxia and had a subsequent dengue infection in the years after vaccination. In children without a previous dengue infection, the vaccine acts as a silent primary dengue infection resulting in a “secondary-like” infection upon their first infection with wild-type DENV and an increased risk of severe disease due to ADE ( Fig 6 ). 108 , 109   After these findings, WHO revised their recommendations for the vaccine to only be given to children with laboratory-confirmed evidence of a past infection. Following WHO’s recommendation, the FDA licensed Dengvaxia in 2019, and in 2021, ACIP recommended routine use of Dengvaxia for children aged 9–16 years with laboratory confirmation of previous DENV infection and living in areas where dengue is endemic. Dengvaxia is the first dengue vaccine recommended for use in the United States.

Proposed mechanism of Dengvaxia efficacy based on prior dengue antigen exposure. Risk of severe disease is represented by color (low = green, medium = yellow, and high = red). Exposure to dengue antigens is represented by mosquito figure for wild-type exposure and by a syringe for Dengvaxia exposure. The first row shows an unvaccinated individual exposed to 4 different dengue serotypes in their life with highest risk for severe disease with second infection and low risk of severe disease in the third and fourth infection. The second row shows an individual without previous dengue exposure who receives Dengvaxia, which acts as a silent primary infection, and then has higher risk for severe disease upon their first exposure to wildtype dengue, the equivalent of the second exposure to dengue antigen. The third row shows an individual with previous wild-type infection who receives Dengvaxia which acts as a silent second dengue exposure with lower risk for severe disease in subsequent exposures to wild-type dengue.

For children aged 9 to 16 years with evidence of previous dengue infection, Dengvaxia has an efficacy of about 80% against the outcomes of symptomatic virologically confirmed dengue (VCD) followed over 25 months as well as hospitalization for dengue and severe dengue as defined by criteria set by the trial’s independent data monitoring committee and followed over 60 months ( Table 3 ). 105 , 106   The efficacy by serotype mirrored its induction of a homotypic immune response 101   with highest protection against DENV-4 (89%), followed by DENV-3 (80%), and lowest against DENV-1 (67%) and DENV-2 (67%) ( Table 3 ). 106   Protection against mortality could not be reported because there were no dengue-related deaths in the phase 3 trials.

Dengvaxia Efficacy by Outcome and by Serotype in Persons 9–16 Years Old with Evidence of Previous Dengue Virus Infection

Pooled vaccine efficacy data are from CYD14 and CYD15 (clinical trial registration: NCT01373281, NCT01374516). CI, confidence interval; VE, vaccine efficacy. Data are presented as perentages.

Follow-up over 25 mo.

Follow-up over 60 mo.

The most frequently reported side effects (regardless of the dengue serostatus before vaccination) were headache (40%), injection site pain (32%), malaise (25%), asthenia (25%), and myalgia (29%) ( n = 1333). 108   Serious adverse events (ie, life-threatening events, hospitalization, disability or permanent damage, and death) within 28 days were rare in both vaccinated participants (0.6%) and control participants (0.8%) and were not significantly different. At 6 months, fewer severe adverse events were reported in the vaccine (2.8%) than in the control arm (3.2%). 108  

Children who were seronegative for dengue at the time of vaccination had increased risk of severe illness on subsequent dengue infections. Risk of dengue-related hospitalization was approximately 1.5 times higher, and risk of severe dengue was approximately 2.5 times higher among seronegative children aged 9 to 16 years who were vaccinated than control participants over a 5-year period. 106  

The requirement for a laboratory test before administration creates a unique challenge for Dengvaxia implementation. In areas with ongoing transmission of flaviviruses other than dengue, qualifying laboratory tests include a positive NAAT or NS1 test performed during an episode of acute dengue or a positive result on prevaccination screening tests for serologic evidence of previous infection that meet specific performance characteristics. In areas without other ongoing flavivirus transmission, a positive dengue IgM assay during an episode of acute dengue is also considered a qualifying laboratory test. 11  

Prevaccination screening is critical because many DENV infections are asymptomatic or do not result in medical visits and testing. Thus, a significant proportion of previously infected individuals who could benefit from the vaccine will not be aware of or have laboratory documentation of their previous dengue infection. 110 – 113   One of the most challenging aspects in selecting a prevaccination test is defining benchmarks for test performance, as explored by several international working groups. 114 , 115   To reduce the risk of vaccinating someone without previous DENV infection, test specificity is a priority. Although test specificity and sensitivity are independent of seroprevalence, positive predictive value (PPV) and negative predictive value are dependent on seroprevalence and describe the likelihood of a true positive if a patient tests positive or the likelihood of a true negative if a patient tests negative ( Table 4 ). In areas with moderate or low seroprevalence (eg, 30%–50%), high test specificity (>98%) is required to achieve a PPV of 90% and therefore reduce the risk of misclassifying seronegative individuals. In these settings, near-perfect specificity at the expense of sensitivity is preferred to minimize the risk of vaccinating a misclassified negative individual and subsequently increasing their risk of severe dengue. However, high-prevalence areas (eg, >60%) would benefit from a higher test sensitivity and more moderate specificity (eg, 95%), which would increase identification of children who would benefit from the vaccine. 116  

Test Performance for a Dengue Prevaccination Screening Test in Different Seroprevalence Scenarios 11  

NPV, negative predictive value; PPV,  positive predictive value.

CDC recommends that prevaccination screening tests that determine previous dengue infection have a minimum sensitivity of 75% and a minimum specificity of 98%. The recommendations also specify that the tests should be used in populations where they will achieve a positive predictive value (PPV) of ≥90% and a negative predictive value (NPV) of ≥75%. These rows demonstrate that tests with the same CDC recommended minimum sensitivity and specificity will have different PPV and NPV depending on the seroprevalence of the population in which they are used.

Because dengue seroprevalence at age 9 to 16 years is estimated to be approximately 50% in Puerto Rico 117 , 118   (where most of the eligible population for Dengvaxia in the United States and its territories and freely associated states reside), the CDC recommends that tests have a minimum sensitivity of 75% and a minimum specificity of 98%. The recommendations also specify that the test performance in the population should achieve a PPV of ≥90% and a negative predictive value of ≥75%. 11   These test characteristics were used to model the risks and benefits of implementing Dengvaxia. Using Puerto Rico’s population and an estimated seroprevalence of 50%, the model found that Dengvaxia vaccination would avert approximately 4148 symptomatic disease cases and 2956 hospitalizations over a 10-year period. This implementation would also result in an additional 51 hospitalizations caused by vaccination of people without previous dengue infection who were misclassified by the screening test. 119   The most common cause of hospitalization among vaccinated children will be breakthrough disease because the vaccine is not 100% efficacious.

TAK-003, developed by Takeda, consists of 2 doses given 3 months apart. The clinical trial population was primarily composed of children aged 4 to 16 years. At 18 months after vaccination, vaccine efficacy was found to be 80.2% against VCD, which waned to 62.0% by 3 years after vaccination. 120 , 121   Efficacy against hospitalization for dengue remained higher, at 83.6% at 3 years after vaccination. Differences in efficacy were observed by history of previous dengue infection, with higher efficacy among persons with previous infection compared with those without previous infection (65.0%–54.3%), and by age, with higher efficacy in older children. In contrast to findings from Dengvaxia at 25 months, children who were seronegative at the time of TAK-003 vaccination did not show an overall increased risk for hospitalization and severe disease compared with the placebo group at 3 years, although efficacy varied by DENV serotype and an age effect could not be ruled out ( Table 5 ). 106 , 120   Efficacy against both VCD and hospitalization varied by serotype and corresponded to the homotypic antibody titers, 102   with highest efficacy against DENV-2 and lowest against DENV-3 and DENV-4. Among children without previous DENV infection, there was no observed efficacy for VCD against DENV-3 or DENV-4. In the safety analysis, the number of serious adverse events was similar between vaccine (2.9%) and placebo (3.5%) groups.

TAK-003 Efficacy by Serostatus, Outcome, Serotype, and Age Group in Persons Aged 4–16 Years Over 36 Months of Follow-Up 120  

Vaccine efficacy data are from clinical trial NCT02747927. CI, confidence interval; VE, vaccine efficacy. Data presented as percentage.

In March 2021, Takeda submitted TAK-003 to the European Medicines Agency for prevention of dengue from any DENV serotype among people aged 4 to 60 years. 122   The company will also be submitting filings to regulatory agencies in Argentina, Brazil, Colombia, Indonesia, Malaysia, Mexico, Singapore, Sri Lanka, and Thailand during 2021 and has future plans to submit to the FDA.

TV003 was developed by the National Institutes of Health and was formulated by selecting serotype-specific components that were determined to provide the most balanced safety and immunogenicity profile based on an evaluation of multiple monovalent and tetravalent candidates. 123 , 124   Because antibody titers failed to predict the efficacy of Dengvaxia, a human infection model was developed to assess the protective immunity induced by TV003 against DENV-2 challenge. Forty-eight volunteers were enrolled and randomized to receive TV003 (24) or placebo (24). Six months later, volunteers were administered a naturally attenuated DENV-2 challenge virus. 125   The primary efficacy endpoint was protection against detectable viremia after challenge. After challenge, DENV-2 was recovered by culture or reverse transcription-polymerase chain reaction (RT-PCR) from 100% of placebo recipients ( n = 20) and 0% of TV003 recipient ( n = 21) ( P < .0001). Postchallenge, rash was observed in 80% of placebo recipients compared with 0% of TV003 recipients ( P < .0001).

TV003 has been licensed to several manufacturers globally, including Merck & Co in the United States and the Instituto Butantan in Brazil. Phase 3 trials in Brazil are underway with efficacy and safety results expected in late 2022 (Clinical trial registration: NCT02406729).

Dengue is the most common arboviral disease worldwide and is projected to increase in range and global burden of disease. Although advancements in the field have progressed incrementally for decades, the recent approval of Dengvaxia for routine use marks a major step forward for control and prevention efforts in the United States and paves the way for future dengue vaccines.

Dengvaxia has several complexities that necessitate future research, including the possibility of fewer doses in the initial schedule followed by booster doses in later years. 30   Because it is the first vaccine to require laboratory testing before administration, public–private partnerships to develop more specific, sensitive, and accessible tests or testing algorithms will be key to minimize vaccination of persons without previous DENV infection and maximize benefit to those with previous infection. Jurisdictions that wish to use Dengvaxia will need to gather seroprevalence data and ensure that prevaccination screening tests meet the requirements for positive and negative predictive values. Furthermore, behavioral science assessments to elicit community-level perceptions and concerns combined with health systems research on optimal “test-and-vaccinate” strategies will result in dengue vaccination programs that are well accepted, efficient, and tailored to individual communities.

TAK-003 and TV003 are in late-stage trials and could soon be approaching licensure. An indication for use in travelers would offer clinicians in nonendemic areas of the United States a prophylactic therapeutic option for their patients. While awaiting the approval of a vaccine with balanced serotype immunity, a mix-and-match strategy guided by differences in serotype-dominant immune responses in each vaccine (TAK-003 followed by Dengvaxia, for example) could potentially lead to higher levels of protection against dengue, but it has yet to be evaluated for safety and efficacy in clinical trials. 126   For all 3 vaccines, studies evaluating efficacy against emerging DENV serotype variants will be important to assess long-term protection induced by the vaccine strains. 10 , 127  

Future vaccines against dengue could also benefit from the lessons learned from the COVID-19 pandemic, namely that new vaccine platform technologies plus political will can result in rapid development of safe and effective vaccines and that clear communication with the public is crucial to successful vaccine implementation. 128 – 130   Dengue vaccines based on an mRNA platform are already under investigation. 131  

Vaccines are a powerful new tool in our arsenal against dengue, but they are only 1 of many interventions, including novel vector control strategies, to control a virus with a complex epidemiology, immunopathogenesis, and clinical picture influenced by climate change, urbanization, poverty, and human migration. Clinicians should remain vigilant in recognizing and diagnosing patients with dengue, because early treatment remains the cornerstone for reducing morbidity and mortality. However, with the recent approval of Dengvaxia, we are 1 step closer on the path to dengue elimination and can expect exciting new developments in dengue interventions in the near future.

We thank Ms Alexia E. Rodriguez, MPH, for her review of the manuscript.

Drs Wong, Adams, and Paz-Bailey conceptualized and designed the structure of the review, drafted portions of the initial manuscript, and reviewed and revised the manuscript; Drs Durbin, Muñoz-Jordán, Sánchez-González, and Volkman drafted portions of the initial manuscript and reviewed and revised the manuscript; Dr Poehling reviewed and revised the manuscript; and all authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work.

FUNDING: No external funding.

CONFLICT OF INTEREST DISCLOSURES: Dr Durbin is a scientific advisor to Merck & Co on dengue vaccine development. The other authors have no conflicts of interest to disclose.

Advisory Committee on Immunization Practices

antibody dependent enhancement

Centers for Disease Control and Prevention

dengue virus

Food and Drug Administration

immunoglobulin M

nucleic acid amplification test

nonstructural protein 1

positive predictive value

plaque reduction neutralization test

virologically confirmed dengue

World Health Organization

Supplementary data

Advertising Disclaimer »

Citing articles via

Email alerts.

Affiliations

• Editorial Board
• Editorial Policies
• Journal Blogs
• Pediatrics On Call
• Online ISSN 1098-4275
• Print ISSN 0031-4005
• Pediatrics Open Science
• Hospital Pediatrics
• Pediatrics in Review
• AAP Grand Rounds
• Latest News
• Pediatric Care Online
• Red Book Online
• Pediatric Patient Education
• AAP Toolkits
• AAP Pediatric Coding Newsletter

First 1,000 Days Knowledge Center

Institutions/librarians, group practices, licensing/permissions, integrations, advertising.

• Privacy Statement | Accessibility Statement | Terms of Use | Support Center | Contact Us
• © Copyright American Academy of Pediatrics

This Feature Is Available To Subscribers Only

Sign In or Create an Account

Sign up for the Health News Florida newsletter

A locally acquired case of dengue fever is reported in hillsborough county.

Symptoms of dengue fever, a mosquito-borne illness, include a high fever, severe headache, eye pain and muscle and joint pain. lt is rarely fatal.

A person has been infected with dengue fever in Hillsborough County.

Health officials say the disease was acquired locally, meaning it was likely transmitted through a mosquito bite.

Dengue fever is spread to humans through the bites of infected female mosquitoes of the Aedes genus, primarily Aedes aegypti .

This is the eighth locally acquired case of dengue fever in Florida this year. Six were in Miami-Dade County and one in Pasco, according to the Florida Department of Health.

There have been 173 cases of dengue fever in Florida this year through May 18 in people who traveled internationally to a dengue-endemic area, according to the department.

Symptoms of dengue fever include a high fever, severe headache, eye pain and muscle and joint pain. It is rarely fatal.

Officials are working to prevent more cases by spraying for mosquitoes.

People should avoid being bitten by wearing protective clothing and staying indoors when mosquitos are most active.

Residents should report dead birds to the Florida Fish and Wildlife Conservation Commission.

Copyright 2024 WUSF Public Media - WUSF 89.7

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• My Bibliography
• Collections
• Citation manager

Save citation to file

Email citation, add to collections.

• Create a new collection
• Add to an existing collection

Add to My Bibliography

Your saved search, create a file for external citation management software, your rss feed.

• Search in PubMed
• Search in NLM Catalog
• Add to Search

A Case of Dengue Fever With Hemorrhagic Manifestations

Affiliations.

• 1 Internal Medicine, Conemaugh Memorial Medical Center, Johnstown, USA.
• 2 Internal Medicine, Allama Iqbal Medical College/Jinnah Hospital, Lahore, PAK.
• 3 Intrenal Medicine, The Wright Center for Graduate Medical Education, Scranton, USA.
• 4 Internal Medicine, Nishtar Medical University and Hospital, Multan, PAK.
• PMID: 32670716
• PMCID: PMC7358921
• DOI: 10.7759/cureus.8581

Dengue fever is an arboviral infection spread by the Aedes mosquito with a wide spectrum of presentations encompassing simple flu-like illness to hemorrhagic manifestations. Hemorrhagic complications range from simple petechiae and purpura to gastrointestinal bleeding, hematuria, and severe central nervous system (CNS) bleeds. Herein we present a case of a 38-year-old male with dengue fever along with its hemorrhagic manifestations. Additionally, we conducted an extensive review of the literature to elucidate pathophysiology, diagnosis, and management of hemorrhagic manifestations in dengue fever.

Keywords: dengue fever/complications; dengue hemorrhagic fever; dhf; mosquito-borne diseases.

Copyright © 2020, Raza et al.

PubMed Disclaimer

Conflict of interest statement

The authors have declared that no competing interests exist.

Figure 1. Multiple purpura and petechiae on…

Figure 1. Multiple purpura and petechiae on the left shoulder

Figure 2. Multiple petechiae on leg

Figure 3. Two large ecchymotic lesions on…

Figure 3. Two large ecchymotic lesions on the patient's back

Similar articles

• Isolated subdural hematoma due to dengue hemorrhagic fever: Surgical intervention and review of the literature. Ashraf M, Hussain SS, Farooq M, Fatima L, Majeed N, Ashraf N. Ashraf M, et al. Surg Neurol Int. 2022 Jun 10;13:244. doi: 10.25259/SNI_334_2022. eCollection 2022. Surg Neurol Int. 2022. PMID: 35855175 Free PMC article.
• The Association between Obesity and Severity of Dengue Hemorrhagic Fever in Children at Wangaya General Hospital. Kurnia B, Suryawan IWB. Kurnia B, et al. Open Access Maced J Med Sci. 2019 Jul 25;7(15):2444-2446. doi: 10.3889/oamjms.2019.660. eCollection 2019 Aug 15. Open Access Maced J Med Sci. 2019. PMID: 31666844 Free PMC article.
• Cerebral vasculitis and lateral rectus palsy - two rare central nervous system complications of dengue fever: two case reports and review of the literature. Herath HMM, Hewavithana JS, De Silva CM, Kularathna OAR, Weerasinghe NP. Herath HMM, et al. J Med Case Rep. 2018 Apr 19;12(1):100. doi: 10.1186/s13256-018-1627-x. J Med Case Rep. 2018. PMID: 29669602 Free PMC article. Review.
• Dengue Hemorrhagic Fever: A State-of-the-Art Review Focused in Pulmonary Involvement. de Almeida RR, Paim B, de Oliveira SA, Souza AS Jr, Gomes ACP, Escuissato DL, Zanetti G, Marchiori E. de Almeida RR, et al. Lung. 2017 Aug;195(4):389-395. doi: 10.1007/s00408-017-0021-6. Epub 2017 Jun 13. Lung. 2017. PMID: 28612239 Free PMC article. Review.
• Dengue hemorrhagic fever: clinical manifestations and management. Kabra SK, Jain Y, Singhal T, Ratageri VH. Kabra SK, et al. Indian J Pediatr. 1999 Jan-Feb;66(1):93-101. doi: 10.1007/BF02752362. Indian J Pediatr. 1999. PMID: 10798041 Review.
• Acute liver failure in dengue haemorrhagic fever. Arora S, Nathaniel SD, Paul JC, Hansdak SG. BMJ Case Rep. 2015;2015:0. - PMC - PubMed
• Dengue hemorrhagic fever and the kidney. Vachvanichsanong P, Thisyakorn U, Thisyakorn C. Arch Virol. 2016;161:771–778. - PubMed
• A case report of dengue haemorrhagic fever complicated with psoas haematoma requiring blood transfusion. Matthias AT, Apsara S, Epa A. BMC Infect Dis. 2019;19:385. - PMC - PubMed
• Acute pancreatitis complicating dengue hemorrhagic fever. Kumar KJ, Chandrashekar A, Basavaraja CK, Kumar HC. Rev Soc Bras Med Trop. 2016;49:656–659. - PubMed
• Systematic review of spontaneous splenic rupture in dengue‐infected patients. Radwan I, Magdy Khattab M, Mahmoud AR, et al. Rev Med Virol. 2019;29:0. - PubMed

Publication types

• Search in MeSH

Related information

Linkout - more resources, full text sources.

• Europe PubMed Central
• PubMed Central
• Citation Manager

NCBI Literature Resources

MeSH PMC Bookshelf Disclaimer

The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Unauthorized use of these marks is strictly prohibited.

• Open access
• Published: 20 June 2024

Molecular surveillance for dengue serotypes among the population living in Moyen-Ogooué province, Gabon; evidence of the presence of dengue serotype 1

• Rodrigue Bikangui 1 , 2 ,
• Soulemane Parkouda 3 ,
• Ayong More 1 ,
• Marien Veraldy Magossou Mbadinga 1 ,
• Ismael Piérrick Mikelet Boussoukou 1 ,
• Georgelin Nguema Ondo 1 ,
• Anne Marie Mouina Nkoma 1 ,
• Rafiou Adamou 1 ,
• Yabo Josiane Honkpehedji 1 , 4 , 5 ,
• Elie Gide Rossatanga 3 ,
• Yuri Ushijima 6 , 7 ,
• Haruka Abe 6 , 8 ,
• Bertrand Lell 1 , 9 ,
• Jean Claude Dejon-Agobé 1 ,
• Jiro Yasuda 6 , 10 , 11 &
• Ayola Akim Adegnika 1 , 2 , 4 , 5 , 12  

Virology Journal volume  21 , Article number:  141 ( 2024 ) Cite this article

84 Accesses

Metrics details

Despite dengue virus (DENV) outbreak in Gabon a decade ago, less is known on the potential circulation of DENV serotypes in the country. Previous studies conducted in some areas of the country, are limited to hospital-based surveys which reported the presence of some cases of serotype 2 and 3 seven years ago and more recently the serotype 1. As further investigation, we extend the survey to the community of Moyen Ogooué region with the aim to assess the presence of the dengue virus serotypes, additionally to characterize chikungunya (CHIKV) infection and describe the symptomatology associated with infections.

A cross-sectional survey was conducted from April 2020 to March 2021. The study included participants of both sexes and any age one year and above, with fever or history of fever in the past seven days until blood collection. Eligible volunteers were clinically examined, and blood sample was collected for the detection of DENV and CHIKV using RT-qPCR. Positive samples were selected for the target sequencing.

A total of 579 volunteers were included. Their mean age (SD) was 20 (20) years with 55% of them being female. Four cases of DENV infection were diagnosed giving a prevalence of 0.7% (95%CI: 0.2–1.8) in our cohort while no case of CHIKV was detected. The common symptoms and signs presented by the DENV cases included fatigue, arthralgia myalgia, cough, and loss of appetite. DENV-1was the only virus detected by RT-qPCR.

Our results confirm the presence of active dengue infection in the region, particularly DENV-1, and could suggest the decline of DENV-2 and DENV-3. Continuous surveillance remains paramount to comprehensively describe the extent of dengue serotypes distribution in the Moyen-Ogooué region of Gabon.

Dengue virus (DENV) infections are the most widely spread arboviral infections worldwide [ 1 , 2 , 3 , 4 , 5 ]. They are endemic in tropical regions where more than 400 million people are exposed each year [ 6 , 7 ]. Dengue fever (DF) is known to be an uncomplicated disease. However, a rapid change to hemorrhagic dengue fever (DHF) can be observed in individuals exposed to more than one of the four known serotypes; DENV-1; DENV-2; DENV-3; and DENV-4 serotype [ 8 ], raising the interest to the secondary heterologous infections in endemic countries [ 9 ].

In Africa, cases of infections due to the DENV were reported in many countries [ 2 , 10 , 11 , 12 ] with non-homogenous distribution of the four genotypes. Indeed, dengue outbreaks were reported in the continent over the past decade, from 2011 to 2021 [ 4 ]. In that period, East Africa was the most affected [ 4 ] with DENV-2 serotype reported in Ethiopia from 2013 to 2018 [ 13 ], in Tanzania from 2014 to 2019 [ 14 ], while DENV-3 serotype was detected in Djibouti in 2014 [ 15 ]. Moreover, all four dengue serotypes were detected in Kenya between 2013 and 2018 [ 16 , 17 ]. During the same period, three West African countries were affected by dengue outbreaks with Burkina-Faso reporting the presence of serotypes 1, 2, and 3 in 2013 and then from 2016 to 2017 [ 18 , 19 ]. In central Africa, Angola and Cameroon reported outbreaks of the serotype 1 in 2013 [ 20 ] and 2017 [ 21 ], respectively. More recently in 2021, serotype 4 was detected for the first time in febrile patients in Yaoundé(Cameroon) [ 22 ]. However, Gabon experienced two concomitant outbreaks of dengue and chikungunya occurring in 2007 and 2010 in which the serotype 2 was reported [ 23 , 24 , 25 , 26 , 27 ]. This increases the risk of severe forms of the disease because of Antibody-dependent enhancement (ADE) can occur after infection [ 9 ]. Even unevenly distributed, the above information provides evidence of the presence of the four serotypes in the continent, increasing the risk of severe forms of the disease among populations and therefore ADE. ADE is a phenomenon in which antibodies that are produced during an initial infection with DENV, can enhance the entry of the same virus into host cells during subsequent infections. This enhancement can lead to more severe illness or increased infectivity. ADE can occur when non-neutralizing or sub-neutralizing antibodies, which are antibodies that do not effectively neutralize the virus, instead facilitate the entry of the virus into target cells by binding to it. This can happen because the antibodies attach to the virus in a way that allows it to bind more efficiently to receptors on host cells, promoting viral entry and replication [ 28 , 29 ]. Since this epidemic period in Gabon, no other outbreak has been reported. However, the presence of serotype 2 and 3 was reported during epidemiological surveys conducted in 2016 and 2017 among febrile individuals in Lambaréné, Gabon [ 2 , 30 , 31 ], indicating a circulation of dengue virus in the population. Recently in 2021, two cases of DENV-1 and one case of chikungunya virus (CHIKV) were reported during a study aiming to assess the cause of fever in hospital-based patients in Lambaréné [ 32 ], indicating the presence of serotypes 1, 2, and 3 in the country. However, less is known about the distribution of dengue serotype in the population and the risk ofADE and severity of the disease. As further investigation, the present survey extends the investigation in the community with the aim to assess the presence of the dengue virus serotypes, as well as to characterize CHIKV infection in the local population, and describe the symptomatology associated with dengue virus infection in a Moyen Ogooué province of Gabon.

Materials and methods

Study design.

This study was a cross-sectional survey conducted from April 2020 to March 2021, where febrile patients were recruited either among those visiting health facilities in the study area, or actively in the community including rural and urban areas.

The study was conducted in the Moyen-Ogooué, one of the nine provinces of Gabon, located in the center of the country. The Moyen-Ogooué province consists of two departments:: The Ogooué et Lacs with Lambaréné (urban area) as the city capital located by road around 240 km from Libreville, the administrative capital of the country; and Abanga Bigne department with Ndjolé (semi-urban area) as the city capital and considered as the second most populated town in the region. Lambaréné and Ndjolé host all administrative structures, including four hospitals equipped with all medical services, several dispensaries, services units, trades, high schools, police stations, modern water, and electricity supply facilities. Lambaréné and Ndjolé are surrounded by several villages (rural areas) with limited health care infrastructures. A 2015 census report indicates that approximately 75% of the 69,287 inhabitants of the region live in urban areas [ 33 ]. The Moyen-Ogooué is known to be endemic for DENV and CHIKV [ 23 , 24 , 30 , 31 ], where a surveillance system for viral diseases with epidemic potential has been established between Institute of Tropical Medicine of the Nagasaki university and the Centre de Recherches Médicales de Lambaréné, a medical research center located in Lambaréné city [ 34 ]where the study was conducted.

Study population

Female and male volunteers of any age, beginning from one year old, who reside in the study area and have fever (axillary body temperature equal to or above 37.5 °C) or a history of fever within the past seven days from the day of inclusion, and who have sought medical care either at a hospital or within the community, were invited to participate in the surveyys.

Sample size consideration

Our study was based on the monitoring of dengue virus infections and the characterization of its serotypes in the population. We therefore included all cases of fever or history of fever encountered in the community or in selected hospitals of the region during the study period.

Study procedure and sample collection

A standardized questionnaire aiming to investigate the presence of clinical symptoms on the examination day or over the past seven days was administed to all eligible participants. Symptoms were recorded and classified in two groups: dengue related symptoms and other symptoms. Subsequently, a 4 ml venous blood sample was collected into a S-Monovette dry tube for the diagnosis of DENV and CHIKV infections. For later, we performed a Rapid Diagnostic Test (RDT) to diagnose malaria infection. Participants seen in the community, with fever at the time of the visit were invited to our research facility at CERMEL to be examined by a study physician. Participants tested positive for malaria were treated according to the national guidelines. For any other diagnostic, a medical prescription was provided to the participant or, if necessary, the participant was referred to an appropriate health care center for a further diagnosis.

Laboratory analysis

All laboratory tests, including molecular detection and sequencing, have been performed at the Immunology and Molecular biology Laboratory of the Centre de Recherches Médicales de Lambaréné (CERMEL). 4 ml venous blood for serum collection was centrifuge at 3000 rpm for 10 min. The collected serum was stored at -80 °C for later usage.

Viral RNA extraction

A total of 140 µl of stored serum was used for viral RNA extraction using the QIAamp RNA mini kit from QIAGEN® (Qiagen, Hilden, Germany) and following the manufacturer’s recommendations. The RNA extracts were then stored at -80 °C for long time.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

RT-qPCR for the detection of DENV-1, DENV-2, DENV-3, DENV4 and CHIKVV was performed in a 20 µl reaction using a One Step PrimeScript RT-qPCR Mix (2X) (TAKARA), which contains TaKaRa Taq HS enzyme. Each reaction mixture contained 10 µl of One Step PrimeScript RT-qPCR Mix, 2 µl of Specific Primer-Probe Mix (PPM), 0.4 µl ROX Reference Dye (50X), and 5.6 µl of H2O RNase-free (PCR grade) added to 2 µl RNA template. RT-qPCR assays were conducted using a Light Cycler 480 instrument (Roche, Basel, Switzerland) under the following conditions: 5 min at 52 °C, 1 min at 95 °C; and 45 cycles of 5s at 95 °C, and 60s at 60 °C. The primers and probes were designed using the sequences reported previously by Santiago [ 35 ]. DENV-1 (FAM-CTC YCC RAG ACG ACT TCA A-BHQ1, Fwd. CAA AAG GAA GTC GYG CAA TA, Rev CTG AGT GAA TTC TCT CTG CTR AAC), DENV-2 (FAM-CTC YCC RAG ACG ACT TCA A-BHQ1, Fwd. CAG GCT ATG GCA CYG TCA CGA T, Rev CCA TYT GCA GCA RCA CCA TCT C), DENV-3 (FAM-ACC TGG ATG TAG GAG CTT G-BHQ1, Fwd. GGA CTR GAC ACA CGC ACC CA, Rev CAT GTC TCT ACC TTC TCG ACT TG YCT), DENV4 (FAM-TYC CTA CYC CCG CAT TCC G-BHQ1, Fwd. TTG TCC TAA TGA TGC TRG TCG; Rev TCC ACC YGA GAC TCC TTC CA). CHIKV (FAM - AAC ATC TGC ACY CAA GTG TAC CAC AAAA GT - MGBEQ, Fwd CAG TGC GGC TTC TTC AAT ATG, Rev CGC ATT TTG CCT TCG TAA TG) Data from the RT-qPCR assays were analyzed using software included in the Light Cycler 480 system. RT-qPCR assays were performed in duplicate and samples showing cycle threshold (Ct) values under 40 were set as positive.

Envelope gene sequencing for genotyping of detected DENV strains

The Amplification of the envelope gene of DENV-1 strain detected was performed using primers designed for two regions R1 (Fwd. CCGATTCAAGATGTCCAACA, Rev -CTTCCACCAATGTGGCTTCT) amplifying one region of 1071pb and R2 (Fwd. AACCACCTTTTGGTGAGACC, Rev GGTTGCTTCGAACATTTTTCC) amplifying a region of 858 pb of Gabon reference strain MG877557-DENV-1-Gabon2012-Env. The analysis was performed with the PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, Shiga, apan) in a reactional mix of 20 µl containing 10 µl of 2x One Step High Fidelity Buffer, 0.4 µl of PrimeScript II RT Enzyme Mix, 1.6 µl of PrimeSTAR GXL, 2 µl of Primer Mix (5 μm), 4 µl of RNase-free water and 2 µl of DENV-1 RNA in the following cycling program: 45 °C for 15 min; 94 °C at 2 min; 30 cycles 98 °C for 10 s; 60 °C for 15s; 68 °C for 1 min; 68 °C for 1 min before an agarose gel purification was performed with a QIAquick Gel Extraction Kit (Qiagen). For the sequence of reactions, PCR products were processed using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) and analyzed using an ABI3500 capillary sequencer (Thermo Fisher Scientific) to obtain sequence data. The serotypes of DENV strains were determined through BLAST analysis of the sequence data ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ).

Phylogenetic analysis

For phylogeny inference of the full-length envelope gene sequences of DENV-1 strains, a Bayesian analysis was performed with timestamped reference sequences, which included complete envelope gene sequences of African DENV-1 strains using Mega software V.4.0 software ( https://www.megasoftware.net ).

Statistical consideration

Data collected were entered into Microsoft Excel 2016 and exported into GraphPad- prism 7 version 4.0 (GraphPad Software, San Diego, CA, USA) for analysis. Statistical analysis was mainly descriptive. Continuous variables were summarized as mean and standard deviation (SD) while categorical variables were summarized as proportion and 95% confidence interval (CI).

Ethics consideration

The study protocol was reviewed by the Scientific Review Committee (SRC) of CERMEL (SRC N°2019-10) and was approved by the Institutional Ethics Committee of CERMEL under the number CEI-008/2019 and the National Ethics Committee of Gabon (CNE-Gabon) under the number PROT N°0085/2019/PR/SG/CNER, respectively. The study procedure, risks and benefits were explained to each participant and those who agree to participate provided a signed informed consent before any study procedure was performed. For illiterate adults, the informed consent process was conducted in the presence of a family (impartial) witness, and both adults signed the consent forms. For children younger than 18 years of age, the signed informed consent was provided by their parents or legal representative. The study was conducted according to the Good Clinical Practice principles of the international conference of harmonization and the declaration of Helsinki requirements.

Study population characteristics

A total of 579 febrile patients were included in the study with a mean (± SD) age of 20 years old (± 20). Of these, as presented in Tables  1 , 319 (55%) were female, given a 1.2 female-to-male sex-ratio. One out of two study participants 306 (53%) came from Lambaréné, the urban area, while 125 (22%) and 148 (26%) of their counterparts came from the semi-urban (Ndjolé) and rural areas, respectively.

Clinical characteristics of the study population

As presented in Tables  2 , 392 (68%) of the participants were enrolled at the health centers while the remaining 32% were seen in the community. At the time of inclusion, 488 (84%) participants had fever, and the other 91 (16%) reported history of fever in the past seven days. The body temperature of our study participants ranged from 36.0 °C to 40.5 °C. A total of 14 different clinical symptoms were recorded. Fatigue (53%, 95%, CI: 49–57), headache (45%, 95%, CI: 44–52), and loss of appetite (48%, 95%, CI: 41–50) represented the main recorded clinical symptoms. Vomiting (33%, 95%, CI: 30–37), abdominal pain (29%, 85%, CI: 25–33), caught (29%, 95%, CI: 25–32), and arthralgia (29%, 95%, CI: 24–32) were less represented. A total of 250 (48%) out of the 579 participants with fever had malaria.

Virus detection

All 579 participants were tested for DENV and CHIKV using RT-PCR. Four participants (0.7%; 95%CI: 0.02–1.8) were positive for DENV serotype 1 (DENV-1) while no case of CHIKV virus was found.

Characteristics and distribution of symptoms among participants with dengue virus infection

Table  3 presents the characteristics of the four participants (two females and two males) positive for DENV-1 and which are 9, 18, 24, and 26 years old,. Among them three recruited in the community and the youngest in the hospital.All of them have their residence in Lambaréné. Regarding the reported symptoms, the two oldest participants had fever at the time of inclusion, while the two others reported history of fever. All of them presented at least five symptoms; with at least four are known to be related to DENV infection. These include fatigue (4 cases), myalgia (3 cases), arthralgia (3 cases) and ear pain (2 cases). For the participant aged 24-year-old, three dengue symptoms were reported: ear pain, breathing difficulties breathing, and an epistasis. None of them reported abdominal pain, but all presented coughed and had a loss of appetite as associated symptoms. None of the four participants positive for DENV were malaria positive.

From all four positive samples, partial envelope glycoprotein gene was sequenced to investigate the genetic characteristics of DENV-1 strains. Two of these positive samples were detected with Ct values above 37. The low yield from genetic material of theses samples have not permitted to get exploitable sequences after sequencing run. Only the two samples CK023 and Ck027 with Ct value 29 and 32 respectively provided good sequences. Figure  1 represents the phylogenetic tree build only with Africans strains characterized during the last decade. The result highlights that the two sequences CK023-CERMEL-BIK-Gabon-2021 and CK027-CERMEL-BIK-2021, registered in Genbank with accession numbers OR135730 and OR135731 respectively, are similar to two strains LC707378 and LC707382 characterized in Lambaréné by Yuri in 2021. These strains belong to a clade in which Gabon strain/2012 is the common ancestor.

Phylogenetic analysis of partial envelope of dengue serotype 1 (1929 bp)

A maximum-likelihood tree was inferred with 1,000 bootstrap replicates. Bootstrap values of ≥ 70% are shown at the main nodes. Virus genotypes and lineages are shown on the right. The Gabonese strains detected in this study are shown in bold and blue.

The aim of the present study was to extend the surveillance of dengue virus serotypes and chikungunya virus in the community by expanding the collection of samples while maintaining routine screening of febrile patients presenting at the hospitals. Our results confirm the presence of dengue infection among hospital patients, and report for the first-time cases of dengue in the community but do not reveal ongoing cases of chikungunya in the study area.

The number of cases of dengue infection could be under or overestimated when surveys are conducted only in health facilities. Indeed, of the four DENV infection cases we found, three of them were found in the community and just one in a hospital setting, giving the evidence of DENV infection in the region. Previous studies reported cases of dengue virus infection from patients recruited in hospitals only [ 2 , 30 , 31 , 32 ]. However, it is known that especially adults do not always go to health center for consultation in case of fever for several social reasons, as well as time and long distances but instead undergo the auto-medication using antipyretic and or antimalarial drugs with favorable outcome. And because of low severity of the infection [ 36 ]. This is particularly true in our region where fever is frequent and generally link to different infectious diseases as malaria, respiratory tract infection, bacterial infection [ 37 ], and mostly viral infection as hepatitis B and C [ 38 ]. Our results therefore emphasize the need to establish a surveillance based on the two settings, including community and hospital-based approaches to have the full picture of dengue infection in our target population.

The dengue virus infection remains active in Lambaréné region even if there is trend of decrease over time. We found a 0.7% (95%CI: 0.3–1.8) prevalence of dengue infection in our study population. This prevalence tend to be lower than the 2% (95%CI: 1.2–3.3) and 1.7% (95%CI: 1.1–2.8) reported respectively by Lim et al. in 2015 [ 31 ] and Abe et al. in 2017 [ 30 ] from febrile patients seen in Lambaréné hospital. Although the difference we observed between our finding and the previous reports is not clearly statistically significant, the trend could indicate a possible decrease in infection incidence in the local population, probably due to the appearance or disappear of dominant serotypes [ 23 , 30 , 31 ], thus reinforcing the idea of implementing surveillance of these viruses and their different genetic forms.

We provided additional evidence of the presence of dengue serotype 1 in our community, and failed to find the other serotypes; 2, 3, and 4 and therefore no risk of Antibody-dependent Enhancement (ADE). Our results could indicate the re-emergence of the serotype 1 in the local population after more than ten years, and a decline of the serotypes 2 and 3 in the region. Indeed, in one hand, the serotype 1 was reported for the first time in Lambaréné during the inter-epidemic period of 2009 with five cases, and in in 2010 with six cases [ 23 ]. The other hand, the serotype 2 has been reported in the two outbreak waves from 2007 to 2010 with 386 cases [ 23 , 24 ], up to 2016 with two cases [ 31 ] while the serotype 3 was reported for the first time in 2010 with one case, and then in 2014 and 2017 with 17 cases in Lambaréné region [ 23 , 30 ]. Indeed, as we did in both the community and hospitals, Yuri et al. reported DENV serotype 1 and none of the other serotypes and this study provides therefore more evidence for that. The dynamic of serotypes over time could indicate constant changes in the ecology of this arbovirus, above all with the temperature increasing which could differently affect the incidence of the dengue serotypes [ 39 ].

Analysis inferred of the phylogenetic tree constructed from the DENV1 sequences obtained indicates the presence of the same DENV-1 strain in Gabon population since 2012. The sequences of DENV-1 strains obtained in this study, are still those previously reported in 2020 by Yuri et al. [ 32 ]. The origin of the phylum indicates that the DENV-1 Gabon 2012 strain from the 2007–2010 epidemic period is their main origin [ 23 ]. So, the DENV-1 strain has been maintained over time, and based on the last seroprevalences reported showing a high exposition rate of the population to arboviruses in the region [ 2 ], we hypothesize existing genetic or environmental factors maintaining the circulation and transmission of the strain over time in a lower intensity. Indeed, as summarized by Lim et al. the transmission of dengue fever is related to several risk factors, including dengue virus’ presence and vitality, mosquitoes’ vectorial behavior and capacity, climate or weather conditions, human immunity, and activity [ 31 ]. In our region, such investigations need to be conducted to have the full picture of DENV in our target population [ 40 ].

Despite a high seroprevalences of CHIKV infection (61%) based on IgG antibodies detection reported in 2016 by Yuri et al. among patients recruited from hospitals in the region [ 2 ], we found no active cases of chikungunya in our study population. The diagnosis of active case of CHIKV infection remains rare in our community. Indeed, except during the epidemic period of 2010 which enable a molecular characterization of the virus in the country [ 24 ], only one case of active CHIKV infection has been reported by Yuri and collaborator in 2021 [ 32 ]. As IgG antibodies to ChikV remain detectable for years, we could assume a very low incidence of CHIKV infection in our community and the high seroprevalence observed could therefore be a result of cumulative cases over years. In addition to the low incidence of CHIKV infection we hypothesized, the absence of active cases we reported which opposes the high seroprevalence of IgG antibodies could also support the hypothesis that CHIKV circulates in the population inducing light clinical manifestation which did not required medical consultation, making difficult to catch active cases. Increase or reduce levels of several biomarkers such as cytokines or coagulation factor (factor VII) have been associated with the severity of CHIKV infection [ 41 ]. In our study area co-endemic with helminth infections known to deeply modulate the host immune system to prevent immune-mediated worm ejection [ 42 ], we can hypothesize a possible interaction between the two infections to explain the low clinical expression of CHIKV infections we observed. Therefore, to have full picture of chikungunya in our community, a community survey remains a important tool.

We were not able to characterize the clinical profile of dengue and chikungunya infection in our study population. The low number of positives cases for dengue virus did not permit to establish a specific dengue infection profile as Nkoghe et al. did in 2010 [ 26 , 27 ]. Indeed, among 53 patients in Franceville, Nkoghe et al. were able to identify a minimum of nine common symptoms [ 26 ]. Only three dengue symptoms were common in our positive patients: fatigue, myalgia, and arthralgia. However, it is well known that these signs are not specific to dengue infection and can also be found in other disease such as malaria or respiratory tract infections which are also frequent in this area [ 43 ].

Surprisingly, we found no malaria-dengue virus co-infection despite that about half of the study population were infected with Plasmodium spp. On the four dengue cases, none was positive for malaria. Our finding is similar to those already reported by Fernandes et al., in 2016 in Lambaréné where an infection rate of 52% was found in hospital patients with fever and no case of arboviruses was found [ 37 ], probably because the study was conducted in hospital and among febrile children aged less than 15. However, our finding opposes the result of Nkenfou et al. who found a malaria-dengue virus co-infection rate of 19.5% in Cameroon [ 44 ]. As indicated by Gebremariam et al. on malaria and acute dengue virus coinfection in Africa [ 45 ], where dengue infection overlaps with malaria, the risk of co-infections is more important. From our side, we hypothesize that the very low prevalence of dengue infection observed explain the absence of co-infection with malaria.

In our study, we did not used the serological methods such as Enzyme Link ImmunoSorbent Assay (ELIZA) to detect IgM (recent infections). This could be presented as a limitation as the seroprevalences may provide the information on the exposure level of population to virus. We indeed focused on active cases. However, serological methods are sometime compromise by cross-reactions due to other pathogens in the same family and do not allow to assess the viral activity. Molecular and genetic methods used in the study allow to detect active infection and give a best virus characterization. The present study focused on Dengue and Chikungunya, the most prevalent arboviruses in the study area. For that reason, but also because of limited resources in our project, we have not extended our investigation to others arboviruses.

Our results indicate the presence of the DENV-1 in the Moyen-Ogooué province, and especially in Lambaréné area. Although we reported a very low infection rate in our target community, our results indicate a necessity to reinforce the genomic surveillance of dengue virus. Community-based surveillance coupled with hospital-based surveillance could therefore be a relevant tool to roll-out the surveillance. Particularly for the early detection of outbreaks and characterization of occurrence of severe diseases related to emergence of DENV-4 or re-emergence of other serotypes 2, and 3 and therefore the risk of Antibody-dependent Enhancement (ADE), as our study provide additional evidence of the presence of serotype 1 in the region.

Data availability

No datasets were generated or analysed during the current study.

Brady OJ, Gething PW, Bhatt S, Messina JP, Brownstein JS, Hoen AG, et al. Refining the global spatial limits of dengue virus transmission by evidence-based consensus. PLoS Negl Trop Dis. 2012;6(8):e1760.

Article   PubMed   PubMed Central   Google Scholar  

Ushijima Y, Abe H, Nguema Ondo G, Bikangui R, Massinga Loembé M, Zadeh VR, et al. Surveillance of the major pathogenic arboviruses of public health concern in Gabon, Central Africa: increased risk of West Nile virus and dengue virus infections. BMC Infect Dis. 2021;21(1):265.

Dieng I, Cunha M, Diagne MM, Sembène PM, Zanotto PMA, Faye O et al. Origin and spread of the Dengue Virus Type 1, genotype V in Senegal, 2015–2019. Viruses. 2021;13(1).

Gainor EM, Harris E, LaBeaud AD. Uncovering the Burden of Dengue in Africa: considerations on Magnitude, Misdiagnosis, and Ancestry. Viruses. 2022;14(2).

Tinto B, Kania D, Samdapawindé Kagone T, Dicko A, Traore I, de Rekeneire N, et al. [Dengue virus circulation in West Africa: an emerging public health issue]. Med Sci (Paris). 2022;38(2):152–8.

Article   PubMed   Google Scholar  

Baba M, Logue CH, Oderinde B, Abdulmaleek H, Williams J, Lewis J, et al. Evidence of arbovirus co-infection in suspected febrile malaria and typhoid patients in Nigeria. J Infect Dev Ctries. 2013;7(1):51–9.

Budodo RM, Horumpende PG, Mkumbaye SI, Mmbaga BT, Mwakapuja RS, Chilongola JO. Serological evidence of exposure to Rift Valley, Dengue and Chikungunya Viruses among agropastoral communities in Manyara and Morogoro regions in Tanzania: a community survey. PLoS Negl Trop Dis. 2020;14(7):e0008061.

Rodriguez-Roche R, Blanc H, Bordería AV, Díaz G, Henningsson R, Gonzalez D, et al. Increasing clinical severity during a Dengue Virus Type 3 Cuban epidemic: deep sequencing of evolving viral populations. J Virol. 2016;90(9):4320–33.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Estofolete CF, Versiani AF, Dourado FS, Milhim B, Pacca CC, Silva GCD, et al. Influence of previous Zika virus infection on acute dengue episode. PLoS Negl Trop Dis. 2023;17(11):e0011710.

Adam A, Jassoy C. Epidemiology and Laboratory Diagnostics of Dengue, Yellow Fever, Zika, and Chikungunya Virus infections in Africa. Pathogens. 2021;10(10).

Makiala-Mandanda S, Ahuka-Mundeke S, Abbate JL, Pukuta-Simbu E, Nsio-Mbeta J, Berthet N, et al. Identification of Dengue and Chikungunya cases among suspected cases of yellow fever in the Democratic Republic of the Congo. Vector Borne Zoonotic Dis. 2018;18(7):364–70.

Proesmans S, Katshongo F, Milambu J, Fungula B, Muhindo Mavoko H, Ahuka-Mundeke S, et al. Dengue and chikungunya among outpatients with acute undifferentiated fever in Kinshasa, Democratic Republic of Congo: a cross-sectional study. PLoS Negl Trop Dis. 2019;13(9):e0007047.

Gutu MA, Bekele A, Seid Y, Mohammed Y, Gemechu F, Woyessa AB, et al. Another dengue fever outbreak in Eastern Ethiopia-An emerging public health threat. PLoS Negl Trop Dis. 2021;15(1):e0008992.

Chipwaza B, Sumaye RD, Weisser M, Gingo W, Yeo NK, Amrun SN, et al. Occurrence of 4 Dengue Virus Serotypes and Chikungunya Virus in Kilombero Valley, Tanzania, during the Dengue Outbreak in 2018. Open Forum Infect Dis. 2021;8(1):ofaa626.

Le Gonidec E, Maquart M, Duron S, Savini H, Cazajous G, Vidal PO, et al. Clinical survey of dengue virus circulation in the Republic of Djibouti between 2011 and 2014 identifies serotype 3 epidemic and recommends clinical diagnosis guidelines for Resource Limited settings. PLoS Negl Trop Dis. 2016;10(6):e0004755.

Langat SK, Eyase FL, Berry IM, Nyunja A, Bulimo W, Owaka S, et al. Origin and evolution of dengue virus type 2 causing outbreaks in Kenya: evidence of circulation of two cosmopolitan genotype lineages. Virus Evol. 2020;6(1):veaa026.

Lutomiah J, Barrera R, Makio A, Mutisya J, Koka H, Owaka S, et al. Dengue outbreak in Mombasa City, Kenya, 2013–2014: Entomologic investigations. PLoS Negl Trop Dis. 2016;10(10):e0004981.

Im J, Balasubramanian R, Ouedraogo M, Wandji Nana LR, Mogeni OD, Jeon HJ, et al. The epidemiology of dengue outbreaks in 2016 and 2017 in Ouagadougou, Burkina Faso. Heliyon. 2020;6(7):e04389.

Tarnagda Z, Cissé A, Bicaba BW, Diagbouga S, Sagna T, Ilboudo AK, et al. Dengue fever in Burkina Faso, 2016. Emerg Infect Dis. 2018;24(1):170–2.

Parreira R, Conceição C, Centeno-Lima S, Marques N, Saraiva da Cunha J, Abreu C, et al. Angola’s 2013 dengue outbreak: clinical, laboratory and molecular analyses of cases from four Portuguese institutions. J Infect Dev Ctries. 2014;8(9):1210–5.

Nemg Simo FB, Sado Yousseu FB, Evouna Mbarga A, Bigna JJ, Melong A, Ntoude A, et al. Investigation of an outbreak of Dengue Virus Serotype 1 in a rural area of Kribi, South Cameroon: a cross-sectional study. Intervirology. 2018;61(6):265–71.

Article   CAS   PubMed   Google Scholar  

Nana-Ndjangwo SM, Djiappi-Tchamen B, Mony R, Demanou M, Keumezeu-Tsafack J, Bamou R et al. Assessment of Dengue and Chikungunya Infections among Febrile patients Visiting Four Healthcare Centres in Yaounde and Dizangue, Cameroon. Viruses. 2022;14(10).

Caron M, Grard G, Paupy C, Mombo IM, Bikie Bi Nso B, Kassa Kassa FR, et al. First evidence of simultaneous circulation of three different dengue virus serotypes in Africa. PLoS ONE. 2013;8(10):e78030.

Caron M, Paupy C, Grard G, Becquart P, Mombo I, Nso BB, et al. Recent introduction and rapid dissemination of Chikungunya virus and Dengue virus serotype 2 associated with human and mosquito coinfections in Gabon, central Africa. Clin Infect Dis. 2012;55(6):e45–53.

Leroy EM, Nkoghe D, Ollomo B, Nze-Nkogue C, Becquart P, Grard G, et al. Concurrent chikungunya and dengue virus infections during simultaneous outbreaks, Gabon, 2007. Emerg Infect Dis. 2009;15(4):591–3.

Nkoghe D, Kassa RF, Bisvigou U, Caron M, Grard G, Leroy EM. No clinical or biological difference between Chikungunya and Dengue Fever during the 2010 Gabonese outbreak. Infect Dis Rep. 2012;4(1):e5.

Nkoghe D, Kassa RF, Caron M, Grard G, Mombo I, Bikié B, et al. Clinical forms of chikungunya in Gabon, 2010. PLoS Negl Trop Dis. 2012;6(2):e1517.

Guzman MG, Kouri G. Dengue haemorrhagic fever integral hypothesis: confirming observations, 1987–2007. Trans R Soc Trop Med Hyg. 2008;102(6):522–3.

Halstead SB, Shotwell H, Casals J. Studies on the pathogenesis of dengue infection in monkeys. II. Clinical laboratory responses to heterologous infection. J Infect Dis. 1973;128(1):15–22.

Abe H, Ushijima Y, Loembe MM, Bikangui R, Nguema-Ondo G, Mpingabo PI, et al. Re-emergence of dengue virus serotype 3 infections in Gabon in 2016–2017, and evidence for the risk of repeated dengue virus infections. Int J Infect Dis. 2020;91:129–36.

Lim JK, Fernandes JF, Yoon IK, Lee JS, Mba RO, Lee KS, et al. Epidemiology of dengue fever in Gabon: results from a health facility-based fever surveillance in Lambaréné and its surroundings. PLoS Negl Trop Dis. 2021;15(2):e0008861.

Ushijima Y, Abe H, Mbadinga M, Ondo GN, Bikangui R, Agnandji ST, et al. Re-emergence of dengue, Chikungunya, and Zika viruses in 2021 after a 10-year gap in Gabon. IJID Reg. 2022;5:68–71.

finances Mdleed. Résultats Globaux Du recensement général de la population et des logements de 2013 Du Gabon (RGPL-2013), Libreville, Direction générale De La Statistique. Wikipedia.org; Decembre; 2015.

Ramharter M, Agnandji ST, Adegnika AA, Lell B, Mombo-Ngoma G, Grobusch MP, et al. Development of sustainable research excellence with a global perspective on infectious diseases: Centre De Recherches Médicales De Lambaréné (CERMEL), Gabon. Wien Klin Wochenschr. 2021;133(9–10):500–8.

Santiago GA, Vergne E, Quiles Y, Cosme J, Vazquez J, Medina JF, et al. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus. PLoS Negl Trop Dis. 2013;7(7):e2311.

WHO. Dengue and severe Dengue 2023 [ https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue .

Fernandes JF, Held J, Dorn M, Lalremruata A, Schaumburg F, Alabi A, et al. Causes of fever in Gabonese children: a cross-sectional hospital-based study. Sci Rep. 2020;10(1):2080.

Abe H, Ushijima Y, Bikangui R, Ondo GN, Pemba CM, Zadeh VR et al. Genetic diversity of Hepatitis B and C viruses revealed by continuous surveillance from 2015 to 2021 in Gabon, Central Africa. Microorganisms. 2023;11(8).

Fan J, Wei W, Bai Z, Fan C, Li S, Liu Q, et al. A systematic review and meta-analysis of dengue risk with temperature change. Int J Environ Res Public Health. 2014;12(1):1–15.

Li C, Lu Y, Liu J, Wu X. Climate change and dengue fever transmission in China: Evidences and challenges. Sci Total Environ. 2018;622–623:493–501.

Ferreira AS, Baldoni NR, Cardoso CS, Oliveira CDL. Biomarkers of severity and chronification in Chikungunya fever: a systematic review and meta-analysis. Rev Inst Med Trop Sao Paulo. 2021;63:e16.

Maizels RM, Smits HH, McSorley HJ. Modulation of host immunity by Helminths: the expanding repertoire of Parasite Effector molecules. Immunity. 2018;49(5):801–18.

Lim JK, Fernandes JF, Yoon IK, Lee JS, Mba RO, Lee KS, et al. Epidemiology of dengue fever in Gabon: results from a health facility-based fever surveillance in Lambarene and its surroundings. PLoS Negl Trop Dis. 2021;15(2):e0008861.

Nkenfou CN, Fainguem N, Dongmo-Nguefack F, Yatchou LG, Kameni JJK, Elong EL, et al. Enhanced passive surveillance dengue infection among febrile children: Prevalence, co-infections and associated factors in Cameroon. PLoS Negl Trop Dis. 2021;15(4):e0009316.

Gebremariam TT, Schalling H, Kurmane ZM, Danquah JB. Increasing prevalence of malaria and acute dengue virus coinfection in Africa: a meta-analysis and meta-regression of cross-sectional studies. Malar J. 2023;22(1):300.

Download references

Acknowledgements

We are grateful to, MOULOUNGOU MANGUI Charlene, N’NEGHE NTOGOU Davila Marthe, and Kenia CONIQUET for helping with sample treatments in the Lab. BACHE Emmanuel Bache for your assistance in review paper. The authors thank the MTN-OCEAC coordination team project for technical and administrative assistance. We Thank CERMEL institution for technical and scientific contribution in the performing of this job. AAA, JCDA and RB are members of the CANTAM(EDCTP-RegNet2015-1045).

This study was supported by the OCEAC MTN project funded by KFW (BMZ – Nr 2015.69.227 + BMZ – Nr 2016.68.797). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author information

Authors and affiliations.

Centre de Recherches Médicales de Lambaréné (CERMEL), Lambaréné, Gabon

Rodrigue Bikangui, Ayong More, Marien Veraldy Magossou Mbadinga, Ismael Piérrick Mikelet Boussoukou, Georgelin Nguema Ondo, Anne Marie Mouina Nkoma, Rafiou Adamou, Yabo Josiane Honkpehedji, Bertrand Lell, Jean Claude Dejon-Agobé & Ayola Akim Adegnika

École doctorale régionale d’Afrique centrale en Infectiologie tropicale, Franceville, Gabon

Rodrigue Bikangui & Ayola Akim Adegnika

Centre Hospitalier Régional George RAWIRI, Lambaréné, Gabon

Soulemane Parkouda & Elie Gide Rossatanga

Department of Parasitology, Leiden University Medical Center (LUMC), Leiden, The Netherlands

Yabo Josiane Honkpehedji & Ayola Akim Adegnika

Fondation pour la Recherche Scientifique (FORS), Cotonou, Benin

Department of Emerging Infectious Diseases, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Nagasaki, Japan

Yuri Ushijima, Haruka Abe & Jiro Yasuda

Division of Biomedical Science, Institute of Medicine, University of Tsukuba, Tsukuba, Japan

Yuri Ushijima

Institute of Tropical Medicine, Vietnam Research Station, Nagasaki University, Nagasaki, Japan

Division of Infectious Diseases and Tropical Medicine, Department of Medicine 1, Medical University of Vienna, Vienna, Austria

Bertrand Lell

National Research Center for the Control and Prevention of Infectious Diseases (CCPID), Nagasaki University, Nagasaki, Japan

Jiro Yasuda

Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan

Institut für Tropenmedizin, Universität Tübingen, and German Center for Infection Research (DZIF), Tübingen, Germany

Ayola Akim Adegnika

You can also search for this author in PubMed   Google Scholar

Contributions

RB, HA, BL, YJ, and AAA conceived and planned the study and its design. RB, SP, REG, MJVMM and YJH performed the field activities with the collected samples. RB, SP, MMM, AM, PMB, YU, NOG, NAM, and HA performed samples treatment and the molecular analyses of the samples. RB, RA, and JCDA analysed the data. RB drafted the manuscript. JCDA, RA, HA, YU, YJ and AAA critically reviewed the manuscript. All authors contributed to the intellectual input of the study. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Rodrigue Bikangui .

Ethics declarations

Ethics approval and consent to participate.

This study was approved by the Institutional Ethics Committee of the Centre de Recherches Médicales de Lambaréné (CERMEL) (CEI-008/2019), and the National Ethics Committee of Gabon (PROT N°0085/2019/PR/SG/CNER). It was also reviewed by the Scientific Review Committee of the CERMEL (RSC N°2019-10).

Consent for publication

All authors concur with the submission presented by the corresponding author.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Bikangui, R., Parkouda, S., More, A. et al. Molecular surveillance for dengue serotypes among the population living in Moyen-Ogooué province, Gabon; evidence of the presence of dengue serotype 1. Virol J 21 , 141 (2024). https://doi.org/10.1186/s12985-024-02406-x

Download citation

Received : 07 December 2023

Accepted : 04 June 2024

Published : 20 June 2024

DOI : https://doi.org/10.1186/s12985-024-02406-x

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Circulation
• Moyen Ogooué

Virology Journal

ISSN: 1743-422X

• Submission enquiries: [email protected]

• Today's news
• Reviews and deals
• Climate change
• 2024 election
• Fall allergies
• Health news
• Mental health
• Sexual health
• Family health
• So mini ways
• Unapologetically
• Buying guides

Entertainment

• How to Watch
• My watchlist
• Stock market
• Biden economy
• Personal finance
• Stocks: most active
• Stocks: gainers
• Stocks: losers
• Trending tickers
• World indices
• US Treasury bonds
• Top mutual funds
• Highest open interest
• Highest implied volatility
• Currency converter
• Basic materials
• Communication services
• Consumer cyclical
• Consumer defensive
• Financial services
• Industrials
• Real estate
• Mutual funds
• Credit cards
• Balance transfer cards
• Cash back cards
• Rewards cards
• Travel cards
• Online checking
• High-yield savings
• Money market
• Home equity loan
• Personal loans
• Student loans
• Options pit
• Fantasy football
• Pro Pick 'Em
• College Pick 'Em
• Fantasy baseball
• Fantasy hockey
• Fantasy basketball
• Download the app
• Daily fantasy
• Scores and schedules
• GameChannel
• World Baseball Classic
• Premier League
• CONCACAF League
• Champions League
• Motorsports
• Horse racing
• Newsletters

New on Yahoo

• Privacy Dashboard

This Florida county reports latest case of dengue fever. Here's what to know

A case of dengue fever was reported in Hillsborough County, the latest report of the mosquito-borne disease in Florida this year.

According to the Centers for Disease Control, there have been at least six cases of locally transmitted dengue in Florida so far in 2024.

Another 172 cases in Florida were travel related.

While most dengue cases reported in the 49 continental US states occur in travelers who visited areas with risk of dengue , limited local spread of dengue has been reported in Florida, Hawaii, Texas, Arizona, and California, the CDC said.

Dengue reported in Hillsborough County in Florida

The Florida Department of Health in Hillsborough County announced Monday, June 24, it had a confirmed human case of locally acquired dengue fever.

DOH-Hillsborough and Hillsborough County Mosquito Control are coordinating surveillance and prevention efforts by conducting aerial spraying.

Miami-Dade reports 6 cases of dengue

There have been six reported locally acquired cases in Miami-Dade County so far in 2024, according to the Florida Department of Health.

In comparison, in 2023, there were 173 locally acquired dengue cases in Miami-Dade County.

What is dengue?

Dengue is a viral disease caused by any of the four related viruses: dengue virus 1, 2, 3, and 4, according to the Centers for Disease Control.

People are infected through the bite of certain species of mosquitoes, primarily  Aedes aegypti , but also  Aedes albopictus , both of which are present in Florida , according to the Florida Department of Health.

What are the symptoms of dengue?

The most common dengue symptoms are fever with:

Aches and pains (eye pain, typically behind the eyes, muscle, joint, or bone pain)

Nausea, vomiting

Mild symptoms of dengue can be confused with other illnesses that cause fever, the CDC said.

Symptoms of dengue typically last two to seven days.

Most people will recover after about a week.

When to seek emergency help

Severe dengue is a medical emergency , the CDC said. Warning signs usually begin in the 24 to 48 hours after your fever has gone away.

"About 1 in 20 people who get sick with dengue will develop severe dengue. Severe dengue can result in shock, internal bleeding, and death." A blood test is the only way to confirm the diagnosis.

Go to a local clinic or emergency room if you have any of the following symptoms:

Belly pain or tenderness

Vomiting (at least three times in 24 hours)

Bleeding from the nose or gums

Vomiting blood, or blood in the stool

Feeling extremely tired or restless

If you think you have dengue, here's what you should do

See a healthcare provider if you develop a fever or have symptoms of dengue. Tell him or her about any recent travel.

Rest as much as possible.

Take acetaminophen  to control fever and relieve pain.

Do not take aspirin or ibuprofen, the CDC said.

Drink plenty of fluids to stay hydrated. Drink water or drinks with added electrolytes.

For mild symptoms, care for a sick infant, child, or family member at home.

Florida history and dengue

"Until 2009, there were no reports of dengue acquired in Florida since 1934," according to the Florida Department of Health.

"In 2009-2010, an outbreak of dengue was identified in Key West. A total 22 persons were identified with dengue fever in Key West during the summer and fall of 2009. In 2010, 66 cases of locally acquired dengue associated with Key West were reported in Florida with onset dates between March and November 2010.

"There was also a  Martin County outbreak  in 2013. In 2020, dengue transmission was detected in Key Largo."

Other mosquito-borne illnesses seen in Florida

Dengue is only one of several mosquito-borne illnesses that have been seen in Florida over the years.

Among the diseases are:

West Nile virus

Eastern equine encephalitis

St. Louis encephalitis

Chikungunya

Take precautions to reduce number of mosquitoes

The Florida Department of Health suggested the following tips to help prevent mosquitoes from hatching:

Drain water from outside areas to reduce the number of places mosquitoes can lay their eggs and breed, including:

Drain water from garbage cans, house gutters, buckets, pool covers, coolers, toys, flowerpots or any other containers where sprinkler or rainwater has collected.

Discard old tires, bottles, pots, broken appliances and other items not being used.

Empty and clean birdbaths and pets’ water bowls at least twice a week.

Protect boats and vehicles from rain with tarps that do not accumulate water.

Maintain swimming pools in good condition and chlorinated. Empty plastic swimming pools when not in use.

What type of repellent keeps mosquitoes away? How do you keep them outside?

Use protective clothing while outdoors and keep doors and windows closed to prevent mosquitoes from going indoors.

Wear shoes, socks, long pants and long sleeves while outside when and where mosquitoes are most prevalent to discourage mosquitoes from biting.

Apply insect repellent that contains DEET (10-30%), picaridin, oil of lemon eucalyptus, para-menthane-diol, 2-undecanone or IR3535.

Treat clothing and gear with products containing 0.5%. Do not apply permethrin directly to skin. Some sports clothing and gear come pretreated with permethrin.

Use mosquito netting to protect children younger than 2 months old.

Check and repair screens on doors and windows. Keep them closed and use air conditioning when possible.

Make sure window screens are in good repair to reduce the chance of mosquitoes indoors.

This article originally appeared on Treasure Coast Newspapers: Dengue reported in Hillsborough, Miami-Dade counties. Mosquito illness

• Today's news
• Reviews and deals
• Climate change
• 2024 election
• Fall allergies
• Health news
• Mental health
• Sexual health
• Family health
• So mini ways
• Unapologetically
• Buying guides

Entertainment

• How to Watch
• My watchlist
• Stock market
• Biden economy
• Personal finance
• Stocks: most active
• Stocks: gainers
• Stocks: losers
• Trending tickers
• World indices
• US Treasury bonds
• Top mutual funds
• Highest open interest
• Highest implied volatility
• Currency converter
• Basic materials
• Communication services
• Consumer cyclical
• Consumer defensive
• Financial services
• Industrials
• Real estate
• Mutual funds
• Credit cards
• Balance transfer cards
• Cash back cards
• Rewards cards
• Travel cards
• Online checking
• High-yield savings
• Money market
• Home equity loan
• Personal loans
• Student loans
• Options pit
• Fantasy football
• Pro Pick 'Em
• College Pick 'Em
• Fantasy baseball
• Fantasy hockey
• Fantasy basketball
• Download the app
• Daily fantasy
• Scores and schedules
• GameChannel
• World Baseball Classic
• Premier League
• CONCACAF League
• Champions League
• Motorsports
• Horse racing
• Newsletters

New on Yahoo

• Privacy Dashboard

Local case of dengue fever from mosquito bite confirmed in Hillsborough County

The Florida Department of Health in Hillsborough County has confirmed one case of locally acquired dengue fever caused by a mosquito bite.

• SuperBalita Cebu
• SuperBalita Davao
• Palarong Pambansa
• Board Exam Results

Central Visayas dengue cases close to 8,000 in 1st half of 2024

CLOSE to 8,000 dengue cases have been recorded in Central Visayas in the first half of 2024.

The Department of Health (DOH) Central Visayas recorded a total of 7,922 dengue cases from January to June 15, 2024, said DOH Regional Epidemiologist Eugenia Mercedes Cañal in a press conference on Tuesday, June 25.

Based on the DOH records, Inabanga town in Bohol has the most number of cases with 424, followed by the town of Tagbilaran with 230.

Other towns in Central Visayas that have recorded the most number of dengue cases were Danao City, Cebu with 156 cases, Toledo City with 144, and Buenavista in Bohol with 134.

This year's cases are higher than of the same period in 2023, which had 3,246 cases according to a data posted on crisis24's website.

Cañal said while dengue is common during rainy season, it is still relevant during El Niño.

Cañal said the case fatality rate in Central Visayas is only below one percent, which according to her, it means "we have better referral or they can refer to our capable hospitals."

Cañal reminded the public to practice the 4 o'clock habit, which means (1) Search and Destroy, clearing up of stagnant water and trimming of plants for a possibility of eggs hatching; (2) Protection, wearing of long sleeves and pants or applying anti-repellent lotion; (3) Seeking Early Consultation, immediate consultation should be done right after experiencing symptoms and (4) Saying yes to fogging when there's an intending outbreak.

She added that there were studies that said long sleeve's colors could attract mosquitoes, but as long as you wear this type of clothing, there could be a least possibility of mosquito bite.

She also shared her experience when she acquired dengue 20 years ago.

“Well, kung doctor ka, imo gyod i-deny nga dengue na siya, but don't be like me, when you have that fever already... persistent, intermittent...on and off man ang pattern of dengue," said Cañal.

Cañal also emphasized the importance of hydration for dengue patients.

"Dengue does not have any medication, there is no antiviral. In every case, you lose 10 percent of your body's water because dengue wants to dehydrate you. So you need to seek early consultation with your doctor to manage these symptoms," she added. (Kate Theresse Hamili/HNU intern and Stephanie Joy Famoso/NWSSU Intern)

Branded Content

• Log In Crisis24 Watchlists arrow Crisis24 Horizon arrow Global Risk Forecast 2024 arrow Worldcue Companion arrow Worldcue Traveler arrow GardaWorld Travel Security Platform arrow TopoONE by Crisis24 arrow Background Checks – IN DEPTH arrow GardaWorld Website arrow

Solutions & Expertise

Discover How We are Different

Find Out More

• Crisis & Security Consulting arrow
• Travel Risk Management arrow
• Journey Management arrow
• Medical & Security Assistance arrow
• Global Medical Solutions arrow
• Crisis Response arrow
• Private Strategic Group arrow
• Risk Intelligence arrow
• Embedded Intelligence arrow
• Event Risk Management arrow
• Training arrow
• Crisis24 Horizon arrow
• TopoONE by Crisis24 arrow
• Courses arrow
• Crisis24 Watchlists arrow
• People arrow
• Organizations arrow
• Assets arrow
• Cyber arrow
• Israel Conflict arrow
• 2024 Olympics arrow

Insights & Intelligence

Access Our Library of Risk Management Content

• Articles arrow
• Webinars, Podcasts & Videos arrow
• Events arrow
• White Papers arrow
• Case Studies arrow
• 2024 Global Risk Forecast arrow
• Risk Alerts arrow
• Watchlists arrow
• Country Reports arrow
• Our Experts

Find out more about Crisis24

• About Us arrow
• Careers arrow
• Sustainability (ESG) arrow

24 Jun 2024 | 01:14 PM UTC

India: elevated dengue fever activity reported in multiple areas in karnataka in june, elevated dengue fever activity reported in multiple areas in karnataka, india, in june. avoid mosquito bites..

Health authorities have reported elevated dengue fever activity in multiple areas in Karnataka, with 4,886 total cases reported Jan. 1-June 18. This is compared to the 2,003 cases reported during a similar period in 2023. Mysore (377 cases) is the most affected district, with disease activity reported in Chikkamagaluru (346 cases), Haveri (272 cases), and Kalaburagi (153 cases). Health officials urge the public to take the necessary dengue fever prevention measures. This report represents the most complete data available as of June 24.

If you have previously been infected with dengue fever, consult with your physician regarding vaccination. Avoid mosquito bites and remove standing water to reduce the number of biting mosquitoes. Seek medical attention if symptoms develop within two weeks of being in affected areas. Do not use aspirin or ibuprofen products if dengue fever is suspected, as these could exacerbate bleeding tendencies associated with the disease.

Dengue fever is considered a year-round and nationwide risk in India, with the highest risk typically occurring from June to September. Authorities reported approximately 16,566 dengue fever cases in Karnataka in 2023, 9,889 cases in 2022, 7,393 cases in 2021, and 3,823 cases in 2020.

Dengue fever is transmitted through the bite of an infected mosquito. Risk of infection is often highest in urban and semi-urban areas. Symptoms of dengue fever include a sudden onset of fever and at least one of the following: severe headache, severe pain behind the eyes, muscle and/or joint pain, rash, easy bruising, and/or nose or gum bleeding. Symptoms typically appear 5-7 days after being bitten, but can develop up to 10 days after exposure. Dengue fever can progress to a more severe form known as dengue hemorrhagic fever (DHF). DHF can be fatal if it is not recognized and treated in a timely manner. There are two dengue fever vaccines, Dengvaxia (CYD-TDV) and Qdenga (TAK-003). Dengvaxia is only recommended for individuals with a history of dengue infection and who live in dengue-endemic countries or areas. Qdenga is recommended for use in children aged 6–16 in settings with high dengue burden and transmission intensity. Check with your healthcare provider if dengue vaccination is needed.

Israel Hamas conflict

Intelligence analysis.

You have used up all your available views for this 30‑day period

For unlimited access to crisis24 risk alerts and country reports, simply register for free., this is your last available risk alerts and/or country reports view for this 30‑day period free risk alerts and/or country reports views remaining in this 30‑day period free risk alerts and/or country reports view remaining in this 30‑day period.

COMPANY is now part of the GardaWorld family of companies, all services are now offered under the Crisis24 brand. You have been automatically redirected to crisis24.garda.com.