further research eq2

The Obelisk of Lost Souls AA Quests
Obelisk of Lost Souls Quests
Shattered Lands Quests
Tier 5 Quests
Tier 5 Solo Quests
Solo Quests
ZAM Credits

List of Acquisitions for the Continuing of Research

Edit source


· ·

Information

( )

40 )

Examine , a chest drop from within the zone.


none	none

What does this information mean?

Description [ ]

As the shifting draws near, we must be sure to have suitable hosts prepared and ready. This matter is serious and requires your full cooperation. Those that have been chosen to be seeds, must have an adequate host for their spirit, it has been decided that goblins of high intelligence would be the best use currently. These hosts will need to be brought to the vestibule for their transformation.

A player must have completed or be on this quest in order to spawn the final boss of the associated instance .
The actual level and difficulty for this quest is higher than what is listed in your journal. You will need to be able to kill level 48-50 heroics to enter The Vestibule instance and kill the boss to complete the quest.
Go to Runnyeye and kill Blikritz Bauble-eye at ( 153, -16, -117 ) Copy /waypoint 153, -16, -117 . If he is not there at the time, kill the goblins in the area and wait for a respawn. Eventually he will spawn by himself in his room.
Only the group member who clicks on the Vestibule door will have the quest updated.
Slay The Medium of Hykor at ( -477, 407, 396 ) Copy /waypoint -477, 407, 396 to unlock the door to the lower room. Interact with one of the six tables in this room to complete the quest.

Optional extra ring event [ ]

You can receive more unconscious goblins when you enter the room. If you look to your right, there is a bag in a slot on the wall you can search. Take six goblins place one on each of the six tables.
The goblins are 38-42^^ and have 2 non-linked adds.
When you kill the goblin, another shadowed man will spawn behind another table and the 2 minutes cycle repeats again.
When you kill the last of the 6 goblins, a lvl 49^^ named will spawn ( Bovauk or Malisient ) with 2 adds.

Rewards [ ]

Credits [ ].

EQ2i credits at for some of the info in this article.

1 Tradeskill Timeline
2 Year of Darkpaw Timeline
3 Scorched Sky

EverQuest II: A reference

Resource	Description
	The most expansive wiki for EverQuest 2, contains information about practically everything.
	An expansive website with information about house items, and a searchable database where you can look up how to craft certain items, or list all items in a given recipie book - complete with screenshots.
	Loads of useful information for tradeskilling, on house items and event quests.

Tool	Description
	Character and item information, directly from the DBG servers.
	EverQuest II's numbers for i.e. damage dealt or amount healed have grown extremely large and can be hard to wrap your head around. This tool helps you by breaking down the numbers and allowing you to quickly compare two sets of numbers (ie. old grandmaster spell values vs. new adept). Works well on a phone so you can enter values while in-game.

Direct links to useful resources

Resource	Description
	A list of (almost) all quests. Useful for finding out which quests to purchase as " " versions (ie. which are legendary or above).
	A list and guide for the various questlines in the Renewal of Ro expansion. There are similar pages on for all expansions and other major questlines.
	Contains information about where to find the creatures needed for the wild daily quest.
	Lists the latest patch notes for the live game, as well as archives of previous updates.
	A list of all the various commands you can use in-game, for instance in .
	A discord server frequented by developers and designers, as well as many players. A handy place to find information and ask questions.
	A list and guide for all of the main tradeskill questlines in the game.
	Once you have finished and reached 125 and are ready to head into there is an on the forums that will help you get up to speed in RoR. It will help you sort out your gear and .

Terminology, systems and features

Terminology	Description
	Your account or character may be entitled to receive certain items, for instance pre-order or . You receive these on your character by typing or by selecting "Claim" from the EQII menu.
AA	"Alternate advancement", a way to customize your character by spending points to gain passive and active abilities.
	Items that can be applied/socketed into equpment, enhancing their stats. You can remove adornments from items safely using the ability that you can purchase from any class trainer. The adornments can then be reused and applied to a different item.
Alternate currency	In-game currency that's not the usual coin. For instance currency gained for doing event quests, like during , or from doing daily and weekly quests for current content, which can then be used to purchase specific items.
	Special points that you gain from achievements tied to specific questlines or collections. These were added in the expansion. You can get up to 20 bonus prestige points.
Breakout [housing]	Breaking free of the usual boundaries of the house. Lets you build on larger areas normally not accessible.
	Player-to-player selling of items for in-game currency. Equivalent to market board or auction house in other MMOs. Members can access it anywhere from the EQ2 menu for free, non-members need to visit specific Broker NPCs and use .
,	Crafted ( ) and quested (orb) item that can teleport you instantly to another person in your group in the same zone.
Charged overseer quest	A special type of quest that you can run without using any of the 10 daily quest slots. It does not grant overseer experience.
Chat channel	An in-game serverwide (or even cross-server) channel that you can chat in. By default you're joined to several, like the frequently useful channel.
CoV	, an item that lets you port directly to anyone (or port anyone to you). Granted as a 6th year , hence the name.
pet	A pet that follows you around and, in most cases, gives you stat bonuses. Often offered as part of the of an expansion. You can hide it from view by right clicking on it and selecting "pet options".
	Daybreak cash. The in-game currency bought with real money (or gotten as a 500 DBC stipend each month for being a ). Used to purchase items or services from the , or for various in-game actions, like unlocking for hiring anywhere or speeding up certain actions (most of those can also be sped up from in-game dropped items).
Daily reset	The time your daily quests, objectives and server-defined actions (like the number of quests) reset. This is 11 PM PST, which is in your local time zone. Note that many quests count from the time you completed the previous one, rather than being tied to the server reset (this is true for instance for the familiars wild daily quest).
Dhalgar's Last Call, Stein of Recollection, Stein of the Alesmith	A spell (Dhalgar) and items (Steins) that lets you bind at taverns/bars throughout Norrath, and then use the spell/item to return there. This can let you teleport to zones that don't usually have any way to teleport to. The spell is granted from the meta collection from . The two others you can get from Legends of Norrath lootboxes on the marketplace.
	This is the second "epic" questline, which unlocks a special set of class-specific spells. The questline is no longer required to acquire the spells, you may purchase apprentice versions from the NPC located in either Sanctus Seru or The Blinding once you reach adventure level 120. Higher quality versions of them can be crafted by any crafter that has scribed (you must scribe the apprentice version first, and then each subsequent tier to upgrade).
	This questline grants you a spell equivalent to the old "Epic 1.0" weapons. In order to complete this questline you need to be able to speak Draconic, which you can learn by completing .
Event Slot	An item/character slot added during summer 2023. It is intended for certain special items obtainable through live events. For now only the " " items from the 2023 Summer Jubilee (encompassing tinkerfest, scorched sky and oceansfull).
	What many other games call reputation. Defines how much NPCs belonging to said faction likes (or dislikes) you. Good faction can unlock quests, merchants and other advantages. Bad faction might make the NPCs attack you on sight. Faction ranges from -50K (hates you) to +50K (loves you). The individual steps are -40K (scowls), -30K (threatening), -20K (dubious), -10K (apprenhensive), 0 (indifferent), 10K (amiable), 20K (kindly), 30K (warmly), 40K (ally).
	A special pet that any class can summon that grants a buff. This pet can be leveled, most commonly through familiar XP potions that you get from quests. You can also hide it from view by right clicking on it and selecting "pet options". You can get one random familiar each day by doing the daily quest.
Fast travel/quick access teleport	If you are a member, you may teleport to almost any overland zone instantly by clicking the icon in the upper left corner of your map (accessed through the EQ2 menu, or by default by pressing "m"). Free accounts may also use this for a fee.
	Items that can be exchanged for by feeding them to a or giving them to a guild hall (among others). You need one of each type (water, bone, soil/compost). To unlock the ability to exchange fertilizers in you need to complete the quest .
	The yule event in Norrath. Usually available in December.
Guide quests	Quests given out by guides (special players). Usually grants pretty good rewards, but only offered at specific times. Make sure you are in your servers , as they're usually announced there.
	A chain of abilities that once executed grants a greater effect than the abilities on their own. In group settings several group members contribute to the same heroic opportunity. Each archetype has their own triggering ability that starts an heroic opportunity: for mages, for priests, for fighters and for scouts.
	Players may own an in-game home (or several), which can be decorated with special house items that you can get from many different sources.
	A tradeable item bought for real money that once consumed grants 30 days of membership to your account. Can be bought and sold on the for .
	A token that you get for completing certain . Can be used to purchase house items, appearance equipment, refresh items, a large bag, XP potions and more.
Marketplace	In-game real money store, where various perks like , , apperance items etc. can be bought for .
	A term used to denote people that pay the monthly subscription fee. Unlocks use of the anywhere, doubles gain, allows use of , grants 500 each month, among other benifits.
Mercenary	An NPC that will group with you and assist you in combat. where you can use special mercenary gear, or . The stats on the gear apply to the mercenary.
Mount equipment	You can level your mount, opening up equipment slots. Stats on these items apply to your character.
Named mob/Name	A mob that has a non-generic name (ie. "Lucan" instead of "A Freeport soldier"). These are genereally stronger enemies/bosses.
	A system that lets you send out minions on automated quests, where they bring back loot to you. See for details.
Overseer bag	A separate bag, introduced with overseer season 5 (2023), that can only contain rewards from the system.
PQ/Public Quest	A time limited quest in a specific location that anyone in the zone can join and assist in completing, gaining rewards. Somewhat akin to world quests or FATEs in other MMOs.
	The panda quests (a.k.a. the "travels" of Yun Zi) is a catchup questline that grants you, among other things, some mounts, loads of house items etc. If you have flying and a membership this doesn't take long. In the panda store, for 2021 items search "jubilee", for 2022 search "collector", for 2023 search "botanist".
Plat	Platinum coins, the main in-game currency.
Prestige [item]	Items that require a to use.
	Special rent-free houses, usually either bought on the , received from or as a quest reward. They are generally larger than normal houses.
Resolve	Resolve is a gatekeeping stat. If your resolve is lower than your targets resolve, then your damage dealt will decrease X% amount and damage received will increase X% amount, where X is the difference between your resolve and the targets. For instance, if your resolve is 1000, and the targets is 1100, your damage is reduced 100%, ie. you do no damage. Having a higher resolve than the target has no benefit. It is primarily a stat that indicates what kinds of dungeons and raids you are geared for, and is mainly useful at max level.
	The ability is used to change where you appear when using the ability (also sometimes called your bind point). You may use this in any location in a city of your alignment to change your to that location.
Shiny	Shinies are items that you can find on the ground which can then be added to collections, and complete collections can be turned in for rewards. The name comes from the appearance of uncollected items in-game: they are shiny spots on the ground.
	A main story quest that's pretty much required. Equivalent to campaign (order hall, war, covenant), or main scenario quest (MSQ) in other MMOs.
	Rewards given out based on subscription time (and, earlier, based on expansion ownership). This has largely been replaced with these days, but there are still some nice rewards available from the veteran reward program, like and a , among other things.
Vitality	A pool of bonus experience that regenerates by around 0.5% each real-life hour. When you have vitality you will gain 200% bonus experience. There are separate pools for adventure and tradeskill experience. There are ways to refill your vitality if you run out, purchased with , as a or through the .
	A special inventory where you can store items for appearance use. The items themselves can not be used as regular items any more, but they do not take up any bag or bank space. Additional slots can be purchased for .
Weekly reset	The time available weekly quests refresh. This is Thursday at 11 PM PST, which is in your local time zone.

Tradeskill terminology, systems and features

Terminology	Description
	, allows the creation of .
Blueprints	The tradeskill blueprint system is unlocked by being a member and tradeskill level 125. It lets you auto-craft recipies that you have crafted previously.
Bountiful harvest	Increases your chance to get additional items when harvesting. See the on EQ2 traders for information on how to increase this.
Gathering Goblin	An that lets you summon an NPC that will harvest for you. This can be converted into a buff that increases your harvesting speed by 1.5 seconds by completing the , specifically the sub-questline.
	Also known as Artisan's Harvest Stash. A special 44 slot bag that can only contain harvests, but that comes in addition to all your other bags. Unlocked by completing the .
Pack pony	A pony you can summon that can be sent out to harvest for you. Unlocked by completing up to part 10 of the questline. Completing the entire questline upgrades your pony to also gather rares and holiday harvests. Completing up to part 3 of the unlocks "autonomous harvesting", which lets the pack pony automatically harvest from nodes around you when you're out in the world.
Rare harvest chance	Increases your chance to get rare items when harvesting. See the on EQ2 traders for information on how to increase this.
Red shiny	Special tradeskill . You need to have in your to be able to see them. You get this by completing the questline.
Secondary tradeskills	, and . These are tradeskills that all characters can pick up, regardless of which primary tradeskill they have. Antizark gaming has a . Secondary tradeskills go up to 5*your highest level (as of BoZ, skill level 650).
	Harvesting of specific shadow nodes. The skill allows you to harvest the nodes, while lets you see them. You gain both the skill and the staff by completing the .
	, allows the creation various useful items with abilities (like bonus to tradeskilling, summoning pets or mounts etc.).
	, allows converting of items into components that are used for adorning.

Terminology	Description
	A UI addon that enhances almost every UI component. Improves the default UI by a lot. Includes .
	Adds a huge amount of useful information to your in-game map, as well as maps for zones that don't have any by default. Essential.
	A program that reads your chat log and reacts to events with notifications, for instance about boss mechanics.

Returning player

Concept	Description
	A system that lets you send out minions on automated quests, where they bring back loot to you. See for details.
	A special pet that any class can summon that grants a buff. This pet can be leveled, most commonly through familiar XP potions that you get from quests. You can also hide it from view by right clicking on it and selecting "pet options". You can get one random familiar each day by doing the daily quest.
	A special inventory where you can store items for appearance use. The items themselves can not be used as regular items any more, but they do not take up any bag or bank space. Additional slots can be purchased for .
Mount equipment	You can level your mount, opening up equipment slots. Stats on these items apply to your character.
Fast travel/quick access teleport	If you are a member, you may teleport to almost any overland zone instantly by clicking the icon in the upper left corner of your map (accessed through the EQ2 menu, or by default by pressing "m"). Free accounts may also use this for a fee.
	The panda quests (a.k.a. the "travels" of Yun Zi) is a catchup questline that grants you, among other things, some mounts, loads of house items etc. If you have flying and a membership this doesn't take long. In the panda store, for 2021 items search "jubilee", for 2022 search "collector", for 2023 search "botanist".
Event Slot	An item/character slot added during summer 2023. It is intended for certain special items obtainable through live events. For now only the " " items from the 2023 Summer Jubilee (encompassing tinkerfest, scorched sky and oceansfull).
	"Ascension classes" were added in the Kunark Ascending expansion. They are essentially seperately leveled subclasses that are independent of your primary class, which grants you several new abilities. Max level for ascension classes is 25. The of contains free level 20 ascension class boosts that can be used to boost each of the four ascension classes to level 20. See the and/or the for more details.
Free gear chest	At the beginning of all recent expansions (usually close to the zonein to the first overland zone), starting with , is a chest that contains gear that will get you ready to face the content of that expansion.
Reforging/infusion	Reforging has been removed as of the expansion. Likewise, infusion, while not removed, will not work on items from VoV onwards.
	Once you have finished and reached 125 and are ready to head into there is an on the forums that will help you get up to speed in RoR. It will help you sort out your gear and .
	A summer event where you get a currency for doing daily and weekly quest. Once started the event is usually active until the new one starts the following summer. Even if a new expansion has launched since the ethereal event, it can be useful to get some ethereal currency, as you can buy a mount and upgrades. Daily/weekly quests of the current expansion will grant trackers/currency.
	On the forums there is that will help you get back up to speed.
Video guides	has that can help you get up to speed: , , , , , and .
	A UI addon that enhances almost every UI component. Improves the default UI by a lot. Includes .

YouTubers and content creators

Channel	Description
	EverQuest II video news and guides.
	EverQuest and EverQuest II news and commentary, see also .

Live events


	28 Jun - 12 Jul.

	01 - 08 Jul.
	20 - 22 Jul.

	01 - 08 Aug.
	08 - 22 Aug.
	20 - 22 Aug.

	01 - 08 Sep.
	20 - 22 Sep.

	01 - 08 Oct.
	11 Oct - 05 Nov.
	20 - 22 Oct.

	01 - 08 Nov.
	08 - 19 Nov.
	20 - 22 Nov.

	03 Dec 2024 - 03 Jan 2025.

Expansions and adventure packs

Pack	Description
The Bloodline Chronicles (2005)	Adventure pack. Added new dungeons and quests. .
The Splitpaw Saga (2005)	Adventure pack. Added destructible environment, new dungeons, raids and quests. The main quest zones scale to the character's level. .
Desert of Flames (DoF, 2005)	Expansion. Increased level cap to 60. Added the continent of the . .
The Fallen Dynasty (2006)	Adventure pack. Added the . , .
Kingdom of Sky (KoS, 2006)	Expansion. Increased level cap to 70, added and the zones. , .
Echoes of Faydwer (EoF, 2006)	Expansion. Increased the cap to 100, guild level cap to 60, added the Fae as a playable race and the continent of . .
Rise of Kunark (RoK, 2007)	Expansion. Increased level cap (adventure/tradeskill/guild) to 80, added new trees, added the Sarnak as a playable race and added the continent of . , .
The Shadow Odyssey (TSO, 2008)	Expansion. Increased the cap to 200, added a lot of new dungeons and the continent containing the . , .
Sentinel's Fate (SF, 2010)	Expansion. Increased the level cap to 90, new trees and the lost remnants of the continent of . , .
Destiny of Velious (DoV, 2011)	Expansion. Increased the cap to 300, added flying mounts, public quests the continent of . , .
Age of Discovery (AoD, 2011)	Feature expansion. Increased the cap to 320, added the Beastlord class and . Also added dungeon maker and tradeskill apprentices, which are not relevant in current content.
Chains of Eternity (CoE, 2012)	Expansion. Increased the level cap to 95 and added two zones in the (the Norrathian afterlife). .
Tears of Veeshan (ToV, 2013)	Expansion. Increased the cap to 340, and expanded the . , .
Altar of Malice (AoM, 2014)	Expansion. Increased the level cap to 100, new , added the Aerakyn as a playable race, made spells upgradeable to grandmaster/ancient and added the zones. , .
Rum Cellar (2015)	Adventure pack. Added a new questline and associated dungeons and raids. .
Terrors of Thalumbra (ToT, 2015)	Expansion. Added level agnostic dungeons, and the area in the norrathian underfoot. , .
Kunark Ascending (KA, 2016)	Expansion. Added , gear, the questline, the system and a newly uncovered part of . , .
Planes of Prophecy (PoP, 2017)	Expansion. Increased the level cap to 110, the ascension level cap to 15, guild level cap to 250, added leveling, and added the . , .
Chaos Descending (CD, 2018)	Expansion. Increased the ascension level cap to 20, increased the level cap to 20, added leveling of mounts as well as mount gear, and added additional zones in the . , .
Blood of Luclin (BoL, 2019)	Expansion. Increased the level cap to 120, added the and added the light side of . , .
Reign of Shadows (RoS, 2020)	Expansion. Added new Reign of Shadows prestige , increased the guild level cap to 350, added the Vah Shir as a playable race and added the dark side of . , .
Visions of Vetrovia (VoV, 2021)	Expansion. Increased the level cap to 125, added the system for tradeskilling and added the continent of . , .
Renewal of Ro (RoR, 2022)	Expansion. Increased the cap to 25. Expanded the continent of . , .
Ballads of Zimara (BoZ, 2023)	Expansion. Increased the level cap to 130, added the advanced research system and chrono dungeons. Expanded the . Questlines: , .

by Savanja on Jan 11, 2007

Follow Ten Ton Hammer

The Basics of Alternate Advancements

You're gaining achievement points, but you aren't sure how and you don't quite know what to do with them! Believe me, I know how that goes, I was just about afraid to spend mine when they first were added in game via the Kingdom of Sky expansion, so they piled up and went ignored for a long while.

target=_blank>

I can't tell you exactly how to spend your points without some major research, something that is on the horizons as part of the individual class guides, but I can give you the basics of what they are and how they work! This will make things a lot easier for those of you that are new to the whole achievements thing.

Click here to skip right to the Alternate Advancements for each class

Looking for AA Spec Recommendations? We have those too!

First Things First

Class achievement points were first added with the Kingdom of sky expansion, the sub-class tree was later added with Echoes of Faydwer, and the Shadows tree was added with The Shadow Odyssey. For those that are new to the game, EQ2 used to work on a archetype system which was mostly done away with, but each sub-class still has a class. An example of this is the sub-classes of Monk and Bruiser both belong to the Brawler class, the Shadowknight and Paladin both belong to the Crusader class. If you own both expansions, you will see both the class and sub-class trees of achievement abilities in your achievements window.

These abilities are there for you to further customize your character. The points will essentially boost various stats and abilities that will be useful in your everyday play, so it is important for good end-game play to have these! There are many top end guilds that won't recruit players than don't have all 250 of their APs earned and assigned.

There are caps on how many APs you can earn. You can have 160 until level 70, 200 points until level 80, and 250 total at the level cap of 90.

You will find your achievement trees on your main menu under "Alternate Advancements" once your character has dinged level 10 (assuming you have the expansions). You may spend your point as you earn them, or save them up and spend them all at once. Either way, I strongly suggest that you do your research and find out which lines would most benefit your sub-class, class, and playing style. The best way of doing this is asking around the href="http://forums.tentonhammer.com/forumdisplay.php?f=22">Ten Ton Hammer forum or the SOE official forums . People are always happy to share experiences!

Getting APs and Spending Them

Now that you know where they came from, how does one earn them?

Once you hit top level, adventuring experience is converted into achievement experience, which still give those of us at level cap something to strive for. Before that though you will have to work a bit harder for them. Non-repeated quests, item and location discoveries, heroic named mob kills, and gaining an adventure level are all some of the ways that you will gain achievement experience. As a soloer, questing is your best course of earning the APs. For groupers, hitting those named mobs as often as possible, anytime you go dungeon crawling, will help you earn them faster. You can also scale how much adventure experience versus achievement experience you gain. To do this go to your main EQ2 menu, choose Alternate Advancements then use the slider to determine how much of your adventure experience to convert into achievement experience. This is particularly helpful for those who wish to build their achievement experience and are less concerned about gaining adventure levels.

Once you have them, you need to spend them. How you spend them is, I believe, highly personal. There is great advice out there for the raider, the grouper, and the soloer, and everyone will have an opinion. Study the abilities, know what your stats do for your class, and note what abilities you use the most often. Knowing your class and sub-class is the best way to know what you would benefit from!

To actually spend the points, open up the achievement tree window and click on the starting abilities. Spending in your class and sub-class trees are a bit different. Your sub-class tree (monk, illusionist, assassin, etc) is fairly straight forward. You will see various abilities that you have and adding points to those abilities will enhance the entire spell/CA line. You may hover over the ability to see how a point will enhance it. More points in any ability gives more benefits to that line! Each ability can take a maximum of 5 points, and you must spend points in the previous ability (noted by the lines going from one ability to the next, it turns green when the following ability is unlocked) in order to progress down the tree.

The class (brawler, enchanter, predator, etc) achievements are a bit more complicated and up for far more debate on how to spend points. The trees are arranged by skill; Strength, Agility, Stamina, Wisdom, and Intelligence. In order to spend any points in any give tree, you first need to gain your starter ability. Click on it to place one point and this will make all the trees available for point spending. To progress down the tree, you must spend 4 points in the previous ability, however, to gain the first final ability you need to have spent a total of 22 points in the entire line, to get the 2nd final ability you will need 70 points in each line.

If you have enough points, you may work on more than one line, and you may not need to complete a line to get the benefits that you want.

After you have spent your points, there occasionally comes a time when you may rethink your choices and want to change them. Everyone gets a free respec, which you will find on your achievements window. After that, you might have to pay for them! It gets more costly the more times you respec, so choose wisely. The following NPCs can handle your respec'ing needs:

South Qeynos Mage Tower. Through the red portal, speak with the Achievement Counselor, Wynia Vethe.

North Freeport Academy of Arcane Science. Elevator to the lower level, speak with the Achievement Counselor, Nexa L'Dur.

Western Neriak, in the building next to the horse merchant. Speak with the Achievement Counselor, Tria L'Belk.

Order of Arcane in Kelethin. Speak with the Achievement Counselor, Aelia Naeni.

You don't have to be stuck with just one spec of achievements though. If you are a level 75 crafter or know one, you can create an house item called "Mirror of Reflected Achievements" which will store one achievement spec. This allows you to switch between 2 sets of achievements to suit however you happen to play.

I feel as though research is always important, and even when you cannot always get in game to check out your achievement ability choices, we still have available the AP trees with in game descriptions. We now have all of the class and sub-class trees, so please check 'em out.

Alternate Advancements by class and sub class:

AA Spec Recommendations:

Finding the perfect spec is an art form, but we have done a little (or a lot) of research to find great specs for you to make your own or to tweak as needed. Want to play with various specs or share your own? Check out my favorite AA calculator !

Brawler (Monk and Bruiser)
Crusader (Paladin and Shadowknight)
Warrior (Berserker and Guardian)
Bard (Dirge and Troubador)
Rogue (Brigand and Swashbuckler)
Predator (Assassin and Ranger)
Enchanter (Illusionist and Coercer)
Sorcerer (Wizard and Warlock)
Summoner (Necromancer and Conjurer)
Cleric (Inquisitor and Templar)
Druid (Warden and Fury)
Shaman (Defiler and Mystic)

Good luck and enjoy!

If you have any questions, comments, or corrections for this guide, please contact Savanja .

To read the latest guides, news, and features you can visit our EverQuest II Game Page.

About The Author

Research (EQ2)

Research Assistant NPCs became obsolete with an update on 12/7/2010. To research, access the "Research" tab in your Knowledge book. (default hotkey is "K")

The researchers are currently offering their services to upgrade your spells and combat arts. Players are unable to research an ability until they obtain level 20.

For skills below level 20, they only require less than a day to provide you with your upgrade. After level 20, the higher level the spell you require, the longer it will take to accurately research the components, up to around 30 days.

Research Assistants will only upgrade one spell or ability at a time per character.

Apprentice abilities are upgraded to Journeyman
Journeyman abilities are upgraded to Adept
Adept abilities are upgraded to Expert
Expert abilities are upgraded to Master

It has been estimated that researching a level 90 Apprentice ability fully to Master will take over 75 days. Players can reduce research times by purchasing Journeyman or Expert spell upgrades from crafters or by acquiring Adept or Master books from either mob drops or on the broker.

Should you choose to discontinue research on a specific spell and change to a different one, the research time already spent on the previous ability on your behalf will be applied to the new spell.

	Wikibase™

Research is a pretty inconsistant Tradeskill on TLP’s. 243 is going to be the max you can get Research for a while on a new TLP until you can create PoP spells, which takes place 3 expansions after PoP.

This is a patch note from back in 2017:

As of 10/18/21 I received some feedback that the patch note appears to refer to Researchable spells PoP+ .

What does this mean? It means many spells prior to PoP (but maybe not all) should still be researchable in era (i.e. Kunark thru Luclin), but PoP+ spells are not until 3 expansions later have unlocked.

You can find a list of the Classic Researchable spells >>> HERE <<<.

**Once Binding Powder starts to drop in Secrets of Faydwer you’ll have another path to continue Research as well. **

Research Leveling Guide

Each class arch-type uses its own combine box for research combines. Beastlords seem to be able to use two. They are:

Hybrid Research Kit: PAL RNG SHD BST Prayer Writing Kit: CLR DRU SHM BST Song Writing Kit: BRD Spell Research Kit: NEC WIZ MAG ENC Tome Binding Kit : WAR MNK ROG BER

You can find these at vendors in each hometown. Do an in game FIND on “a spell research merchant” to find a merchant that sells them.

1 – 20

Train at Guildmaster — or proceed to first combine

1 – 54

Vial of Pure Water – Creates 5

Combine in your class research kit

5x Empty Vial – Bought (a spell research merchant (Use FIND ), at any hometown) 4x Water Flask – Bought (a spell research merchant (Use FIND ), at any hometown) 1x Gnomish Heat Source – Bought (a spell research merchant (Use FIND ), at any hometown)

**Save the Vial of Pure Water for the upcoming combines**

55 – 102

Oil of Vitrol This one requires some farming. With the exception of creating spells, this is the last inexpensive way to level up Research without spending loads of platinum . If you are ok with spending some platinum then read the next combines.

1x Crystallized Sulfur – Dropped (Random world drop, most common in level 30+ zones) 1x Saltpeter – Dropped (Lavastorm Mountians, various mobs including goblins, lavaspinners, sprites, drakes, imps, etc) 1x Gnomish Heat Source – Bought (a spell research merchant (Use FIND), at any hometown) 1x Vial of Pure Water – Crafted (Research, Trivial 54, see the 21-54 combine on this guide )

Parchment Solution

This one is expensive, but store-bought.

Estimated 243pp per combine. Sells back for ~ 90pp. Net cost: ~ 153pp per combine if successful

Combine in your class research kit 1x Aqua Regia – Bought (a spell research merchant (Use FIND ), at a hometown) ~ 152pp each 1x Fire Emerald – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 90pp each 1x Gnomish Heat Source – Bought (a spell research merchant (Use FIND), at any hometown) 1x Vial of Pure Water – Crafted (Research, Trivial 54, see the 21-54 combine on this guide )

145 – 174

Fine Parchment Solution

Estimated 266pp per combine. Sells back for ~ 111pp. Net cost: ~ 155pp per combine if successful

1x Aqua Regia – Bought (a spell research merchant (Use FIND ), at a hometown) ~ 152pp each 1x Fire Emerald – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 90pp each 2x Gold Bar – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 10pp each 4x Gnomish Heat Source – Bought (a spell research merchant (Use FIND), at any hometown) 2x Vial of Pure Water – Crafted (Research, Trivial 54, see the 21-54 combine on this guide )

175 – 203

Vellum Parchment Solution

Estimated 290pp per combine. Sells back for ~ 133pp Net cost: ~ 157pp per combine if successful

1x Aqua Regia – Bought (a spell research merchant (Use FIND ), at a hometown) ~ 152pp each 1x Platinum Bar – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 105pp each 3x Gold Bar – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 10pp each 3x Gnomish Heat Source – Bought (a spell research merchant (Use FIND), at any hometown) 1x Vial of Pure Water – Crafted (Research, Trivial 54, see the 21-54 combine on this guide )

204 – 216

Fine Vellum Parchment Solution

~ 390pp per combine. Sells back for ~ 155pp. Net cost: ~ 235pp per combine if successful

1x Aqua Regia – Bought (a spell research merchant (Use FIND), at a hometown) ~ 152pp each 1x Fire Opal – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 41pp each 1x Platinum Bar – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 105pp each 1x Peridot – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 10pp each 1x Vial of Muriatic Acid – Bought (a spell research merchant (Use FIND), at a hometown) ~ 78pp each 2x Gnomish Heat Source – Bought (a spell research merchant (Use FIND), at any hometown) 2x Vial of Pure Water – Crafted (Research, Trivial 54, see the 21-54 combine on this guide )

217 – 243

Runic Parchment Solution This one is expensive, but store-bought.

~ 416pp per combine. Sells back for ~ 178pp. Net cost: ~ 238pp per combine if successful

1x Aqua Regia – Bought (a spell research merchant (Use FIND), at a hometown) ~ 152pp each 1x Gold Bar – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 10pp each 1x Platinum Bar – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 105pp each 1x Star Ruby – Bought (Audri Deepfacet in PoK or JC Merchants in many hometowns) ~ 68pp each 1x Vial of Muriatic Acid – Bought (a spell research merchant (Use FIND), at a hometown) ~ 78pp each 1x Gnomish Heat Source – Bought (a spell research merchant (Use FIND), at any hometown) 2x Vial of Pure Water – Crafted (Research, Trivial 54, see the 21-54 combine on this guide)

Support Kezzan

Join discord.

Subscribe to YouTube!

Get the Reddit app

A subreddit dedicated to all things relating to EverQuest

Why is Everquest 2 so despised, especially in the Everquest 1 community?

I have never actually played EQ2 until recently. I was going to play it, but all my friends pulled me over to wow. When they all quit, I came back to EQ1 and decided not buy EQ2 because it was so hated. I never gave it much more of a thought than that.

When I decided to try out EQ2, it just felt empty. The game play wasn't as fun, The graphics did not look as good as I thought it did back then. Everything looks like plastic and the character models are ugly. The economy on all servers is completely broken due to the numerous plat dupes that were in the game. All the zones, except the zones from the latest expansion have no meaning to go them at all... Kinda like wow where the only zones that have relevance are the ones from the latest expansion. Everything else is just "there". All the servers feel like ghost towns. I couldn't find one other player, even in the major cities.

I cannot get into major details of why I Thought it was bad since I only played it for a day then uninstalled, but what is your personal reasons for disliking EQ2?

Search Forums

| |

Interface Sites

Other...

Go to Page...

		> >

06-26-2022, 09:07 AM

Ceyarrecks

06-26-2022, 01:55 PM

jnils

06-26-2022, 02:56 PM

06-27-2022, 02:27 AM

question: is this file created by the eq2maps application?

In having made use of eq2maps on a win7 system, might I question what the use/purpose is of eq2map.ini file?

06-27-2022, 06:58 AM

06-27-2022, 01:47 PM

1. create EQ2MAP directory within EverQuest II directory containing contents of EQ2MAP_V2_090814.zip [is there a more recent update of the manual-only maps?]

2. create a file named EQ2.ini also within EQ2 directory which contains (just?) the following lines:
cl_ui_subdir UI/
cl_ui_skinname EQ2MAP

06-28-2022, 08:59 PM

06-28-2022, 10:52 PM

06-29-2022, 06:49 AM

Thread Tools

Display Modes

Search this Thread

Posting Rules
post new threads post replies post attachments edit your posts is are code is

- - - - -

Create an Account
Account Management
Membership Info
Enhanced Security
Enter Activation Code
Join newsletter
Buy Daybreak Cash

JavaScript Required

Browser update required.

Mozilla Firefox
Google Chrome
Microsoft Internet Explorer
Apple Safari

Cookies Required

Missed the Livestream? Check out the video here ! Fippy Fest digital tickets are still available!

FIND OUT MORE

Daybreak Cash
Tradable Krono

Add to your adventures with more than a dozen expansions.

Add new races, classes, zones, quests, and more. All expansions are included when you purchase the latest expansion.

Ballads of Zimara

Calamitous impacts upon Norrath were but an overture to the songs of strife and oppression ringing out from the Plane of Sky. Norrathians, venture to the firmament lands in hopes of wresting lasting peace from a despotic foe, the Djinn Sovereign, and his growing army of metallic djinn! In the wake of disastrous impact events near shoreside communities, Norrath's exceptional adventurers and artisans find themselves swept up in a raging struggle for survival in the skies far above! Splendor Sky Aerie, the hooluk’s secluded nest lands, are being invaded. Securing peace for them will mean venturing where few have ever dared - Zimara Breadth, within the deteriorating Plane of Sky! Here, the legendary Djinn Sovereign, commands a ruthless army made up of djinn of all sorts, including something never seen before - maedjinn. These metallic djinn may just hold the clue to his downfall though, when the figure tied to their creation within the Aether Wroughtlands is revealed to be a captive, held deep within Vaashkaani, Alcazar of Zimara. The opulent palace is both throne and dungeon! But is freeing the captive in our future? Can the Djinn Sovereign be defeated? And what of his vast army of maedjinn? The answers are found within the Ballads of Zimara!

See what's included ⁺⁺

To help prevent fraud, TRADABLE items(⁺⁺) included in the Family & Friends edition or upgrade editions will be delivered 72 hours after purchasing.

Expand your arsenal interactively with Advanced Research.
Re-challenge your favorite encounters in Chrono Dungeons.
Discover new Adventure, Tradeskill, and Signature quests as you explore soaring new regions in the Overealm and beyond!
Conquer all new Solo, Heroic, and Raid content in firmamental realms tied to the Plane of Sky, including Aether Wroughtlands.

ONE MEMBERSHIP. ALL THE BENEFITS!

With your DAYBREAK ALL ACCESS MEMBERSHIP get monthly 500 Daybreak Cash, 10% off Marketplace purchases † , and member benefits in EverQuest, EverQuest II, DC Universe Online, and PlanetSide 2.

Australian Dollars
Danish Krone
British Pound Sterling
Norwegian Krone
Swedish Krona
Swiss Franc
Japanese Yen
Brazilian Real
Canadian Dollars
New Zealand Dollars

Access to all previous expansion content included

With your purchase you will also receive access to these expansions' content .

* Available to claim on Time-Locked Expansion servers

** Available for claim at the launch of the expansion

*** Available to be consumed at the launch of the expansion

⁺ Delivered 72 hours after purchase

⁺⁺ Available to claim at the launch of the expansion or 72 hours after purchase, whichever is later.

With your purchase of the latest expansion pack, you also receive access to the following previous expansions' content*:

EverQuest® II Chaos Descending™
EverQuest® II Blood of Luclin™
EverQuest® II Reign of Shadows™
EverQuest® II Visions of Vetrovia™
EverQuest® II Renewal of Ro™

AND this adventure pack comes with the latest expansion purchase:

*Does NOT include premium races or classes, such as the Aerakyn, Vah Shir, Beastlord, nor Channeler.

You are leaving Daybreak’s website to go to a third-party site or service. The third-party site is subject to a different privacy policy, which we encourage you to review.

Privacy Policy Changes

We have updated our Privacy Policy . Please take a moment to familiarize yourself with our privacy practices. If you are a resident of California, please view our California Privacy Disclosure .

Search forums

EverQuest 2 Forums

The norrathian herald, announcements.

Today at 7:48 AM
FalconClash

Update Notes

Yesterday at 7:32 AM

EverQuest II Development

Bug reports.

Resolved Bugs
Today at 8:02 AM
Heimerdinger

Suggestions & Feedback

Resolved Suggestions
1 minute ago

Developer Polls

Resolved Developer Polls
Apr 23, 2024

Class Skill Suggestions

Shadowknight
Illusionist
Necromancer
Swashbuckler

Jun 18, 2024

Test Server Forum

Today at 6:16 AM

Player Discussions

General gameplay discussions.

42 minutes ago

Tips, Tricks, FAQs, & New Player Questions

Yesterday at 7:08 AM

Class Discussions

Yesterday at 5:29 PM

Tradeskills

Sunday at 12:34 PM

History & Lore

Saturday at 11:00 AM

Items & Equipment

Today at 6:26 AM

Zones & Population

Jun 25, 2024

Quests & Seasonal Events

Yesterday at 3:16 PM

Norrathian Homeshow

Today at 7:20 AM

Guild Recruitment

Yesterday at 7:01 AM

Guide Events

Developer Announcements

Special Ruleset Server Discussions

General tle discussions.

11 minutes ago

PvP TLE Discussions

Monday at 4:31 AM

Lore & Legend Discussions

Monday at 7:38 AM

Origins Server Discussions

15 minutes ago

Anashti Sul (Origins) Server Beta

Beta updates.

Jun 7, 2024

Beta General

Resolved Beta Bugs
Top Beta Bugs

Beta Quests

Jun 3, 2024

Jun 14, 2024

Beta Tradeskills

Beta zones & population.

Jun 10, 2024

Players Supporting Players

Today at 8:11 AM

Archived Forum

Daybreak support, latest posts.

Latest: Harek
Latest: Uguv
Latest: Mesander

Latest: TheSpin
25 minutes ago
Latest: Bastiaan

Forum statistics

Share this page.

My Characters

Leaderboards
Recently Discovered Items
Loot Drop Data by Dragon's Armory

StationCash Marketplace
Altar of Malice Gear Browser
Altar of Malice Adornments
Gear Report
Adventure (Quest) Report
Tradeskill Report

Help, FAQ, & EQ2U Update Notes

Spells & Combat Arts
Collections

EQ2Wire Forums
EQ2Wire Discord Chat
EQ2 Furniture
EQ2 Compare Achievements & Collections
Dragon's Armory
Dethdlr's Adornment Calculator v2
Beetny's AA Calculator
EQ2 Traders
EverQuest2.com

	Maj'Dul	Dec 15, 2020 @ 11:07:55 pm
	Test	Dec 15, 2020 @ 11:23:56 pm
	Isle of Refuge	Dec 16, 2020 @ 8:59:50 am
	Thurgadin	Dec 16, 2020 @ 12:09:45 pm
	Antonia Bayle	Dec 17, 2020 @ 3:07:11 am
	Halls of Fate	Dec 17, 2020 @ 3:29:11 am
	Skyfire	Dec 18, 2020 @ 11:47:54 pm
	Rivervale	Dec 21, 2020 @ 2:39:57 am

Open access
Published: 03 July 2024

Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization

Pia Ryt-Hansen 1 ,
Victoria Kyhl Johansen 1 ,
Marta Maria Cuicani 2 ,
Lars Erik Larsen 1 &
Sanni Hansen 3

BMC Veterinary Research volume 20 , Article number: 287 ( 2024 ) Cite this article

Metrics details

Equine herpesvirus 4 (EHV-4) causes respiratory disease in horses, and the virus is considered endemic in the global equine population. However, outbreaks can occur when several horses are gathered in relation to shows, competitions, breeding units and at hospitals. In the spring year 2022, an EHV-4 outbreak occurred at the Large Animal Teaching Hospital, University of Copenhagen, Denmark. Nine horses were tested EHV-4 positive during the outbreak, which lasted approx. seven weeks. In addition, a tenth horse “Eq10” tested EHV-4 positive almost three weeks after the last of the outbreak horses tested positive. Detailed clinical registrations were obtained from all ten horses as well as their location and movement during hospitalization. Nasal swabs were obtained throughout the outbreak and tested by qPCR for EHV-4. Additionally, pre- and post-infection sera were tested for the presence of EHV-4 antibodies. Selected samples were characterized by partial and full genome sequencing.

The most common clinical signs of the EHV-4 infected horses during this outbreak were pyrexia, nasal discharge, mandibular lymphadenopathy and increased lung sounds upon auscultation. Based on the locations of the horses, EHV-4 detection and antibody responses the most likely “patient zero” was identified as being “Eq1”. Partial genome sequencing revealed that Eq10 was infected by another wild type EHV-4 strain, suggesting that the hospital was able to eliminate the outbreak by testing and reinforcing biosecurity measures. The complete genome sequence of the outbreak strain was obtained and revealed a closer relation to Australian and Japanese EHV-4 strains rather than to other European EHV-4 strains, however, very limited sequence data are available from Europe.

The study illustrated the transmission of EHV-4 within an equine facility/hospital and provided new insights into the viral shedding, antibody responses and clinical signs related to EHV-4 infections. Finally, sequencing proved a useful tool in understanding the transmission within the hospital, and in characterizing of the outbreak strain.

Peer Review reports

In the family of Herpesviridae , nine equine herpesviruses (EHV-1-EHV-9) have been defined, with EHV-1, EHV-3, EHV-4, EHV-6, EHV-8 and EHV-9 belonging to the subfamily of Alphaherpesvirinae [ 1 ]. EHV-1 and EHV-4 are two important agents in relation to upper respiratory tract infections in horses [ 2 ]. The two viruses are closely related both genetically and antigenically with considerable level of immunological cross reactivity [ 3 ]. However, EHV-1 distinguishes from EHV-4 by frequent induction of abortions and neurological disease [ 2 , 3 , 4 , 5 ].

The genome of EHV-4 consists of linear double stranded DNA, approximately 145 kilo base pairs (kbp) in length. The genome contains 79 open reading frames (ORFs) [ 5 ] encoding 76 homologous genes, with three genes (ORF 64, 65 and 66) which are duplicated within the repeat regions [ 3 ].

EHV-4 infection can lead to respiratory disease [ 6 ] with clinical signs including lethargy, anorexia, pyrexia, mandibular lymphadenopathy, coughing and nasal discharge [ 4 , 6 , 7 ] with a duration between two and 14 days [ 4 , 8 ]. Clinical disease is most often reported in foals and young horses [ 4 , 6 ]. EHV-4 is transmitted by aerosols and by direct contact [ 7 , 9 ]. Studies have reported a seroprevalence of > 80% in different geographical locations [ 4 ]. A key property of EHV-4 is its ability to establish latent infections. One study revealed that 56/70 horses, euthanized due to none-infectious causes, tested EHV-4 positive in the trigeminal ganglia [ 10 ]. Following the establishment of latency, EHV-4 can be periodically reactivated due to stressors such as transport, other disease, new environment etc., with recrudescence and shedding of EHV-4 as a result [ 2 , 4 , 7 ]. Several studies have performed whole genome sequencing [], whereas other studies solely focused on sequencing of ORF30 and ORF33 [ 11 , 12 ], encoding a catalytic subunit of replicative DNA polymerase and an envelope glycoprotein, respectively. Whole genome sequencing analysis have shown 98.9–99.9% shared nucleotide identity among different Australian EHV-4 strains, corresponding to 179 single nucleotide polymorphisms (SNPs) [ 3 ]. Conversely, a German outbreak at a breeding stable revealed 99.9% identity corresponding to 76–98 SNPs [ 4 ].

The aims of this study were to characterize the genome of an EHV-4 outbreak strain and to describe the transmission and clinical disease related to an acute EHV-4 at a referral hospital.

Real-time qPCR results of nasal swabs (Laboklin and VCM analyses)

Initially, the first three horses showing clinical signs of respiratory disease (Eq1, Eq2 and Eq3) all tested positive for EHV-4 (Fig. 1 ), EHV-5 and Streptococcus equi subspecies zooepidemicus. Additional four horses tested EHV-4 positive after 4–5 days (Eq4, Eq5, Eq6 and Eq7), and the last two horses (Eq8 and Eq9), tested positive eight and 13 days after the first horse tested EHV-4 positive, respectively.

Timeline of the hospitalizations and EHV-4 detections of Eq1-Eq10

The figure illustrates the duration of hospitalization of each of the ten horses (grey) and period from when each horse had its first nasal swab collected that tested EHV-4 positive until the last collected nasal swab tested positive (red). The black horizontal line represents the timeline of the study from April-July 2022. The specific dates of the collection of the nasal swabs are indicated underneath the timelines of each horse. The qPCR test results are both derived from the analyses performed at Laboklin and VCM, and negative PCR results within the “detection period” (red) are not included. The horses are illustrated as either foals ≤ 1 year old (foal symbol) or adult horses > 1 year old (horse symbol)

Eq10 was referred to the hospital for the first time, while the last EHV-4 positive horses (Eq2) was still isolated in the quarantine. However, Eq10 was re-admitted to the hospital 17 days after Eq2 tested EHV-4 positive for the last time.

Three horses did not have consecutive positive EHV-4 tests during the “infection period” (Additional File 1 ). All serum samples tested negative for the presence of EHV-4 by qPCR, except for Eq2, that had one blood sample obtained the 5th of May 2022, with a Ct value of 34.49. A detailed overview of the real-time qPCR results from both laboratories are shown in Additional File 1 .

Pre- and post-infection antibody responses

The ELISA results of the pre- and post-infection sera revealed that only three of the ten horses were naïve to EHV-4 antibodies at the time of arrival at the hospital (Eq2, Eq3 and Eq7) (Fig. 2 ). These were all foals being between ten months to one year of age (Additional File 2 ). Two of these foals subsequently tested positive in the ELISA following EHV-4 infection, whereas the last foal remained negative (Eq3). However, the post-infection sera of this foal was obtained only eight days after the initial EHV-4 positive test result. The remaining seven horses were seropositive already upon arrival. In total, seven horses showed an increase in EHV-4 antibodies following infection. Seven out of the ten horses from the outbreak had an OD value < 1.0 at arrival at the hospital, whereas eight of the horses had an OD value > 1.0 post infection, with seven of them being > 2.0.

EHV-4 antibody ELISA results of the sera obtained from the ten horses pre- and post-infection presented as corrected OD-values

For the post-infection sera the number of days after the initial EHV-4 positive real-time qPCR test results are presented in the parenthesis above the columns. Antibody negative samples are marked with bold letters. The pre-infection sera were obtained at arrival, but for Eq8 and Eq10 additional pre-infection sera were also analyzed (Eq8 = 1.29 and Eq10 = 0,707). In addition, Eq2, Eq4, Eq7 and Eq9 had several post-infection sera analyzed. The grey horizontal line indicates the 0.2 cut-off for a positive ELISA result

Clinical signs

Clinical signs related to the ten EHV-4 infected horses during the outbreak are summarized in Table 1 and included pyrexia, mandibular lymphadenopathy, nasal discharge, ocular discharge, coughing, increased lung sounds and anorexia. Nasal discharge was the most common clinical sign along with pyrexia and increased lung sounds. Detailed clinical registrations for each horse are listed in Additional File 3 . Based on clinical signs, the ten infected horses could be divided into three groups. One group included three horses (Eq4, Eq5 and Eq9) more than ten years old that showed no clinical signs of respiratory disease, or had one day with nasal discharge. The second group consisted of horses below one year of age that were moderately affected characterized by being subfebrile and with mandibular lymphadenopathy, nasal discharge, and increased lung sounds (Eq1, Eq2 and Eq6). Eq1 and Eq2 also had two and one day of mild fever, respectively and Eq2 had several days with coughing registered. The third group included three horses between 11 months to two years of age (Eq3, Eq7, Eq8), and one 7-year-old horse (Eq10) being severely affected with pyrexia for three-five days, nasal discharge and increased lung sounds. None of the severely affected horses had mandibular lymphadenopathy. The reason for admission to the Large Animal Teaching Hospital and other non EHV-4 related clinical signs observed during their hospitalization are listed in Additional File 2 .

Tracing movements of the horses

Eq1 stabled in box 32 E, and Eq3 stabled in the outside box, were the first two horses to test positive for EHV-4 (Fig. 3 ). The horses were transferred to the isolation unit 1 following their first EHV-4 positive test, and remained there until they tested negative. Eq2, Eq4 and Eq5 were all housed in stable E, and were later moved to isolation units 1 or 2. The horses remained individual isolated until being discharged from the hospital. Stable E was closed for intake of patients during most of the outbreak and acted as quarantine for other close-contact horses that had been in contact with the first positive confirmed infected horse, and later in the outbreak period, it became isolation unit due to lack of space in the isolation unit. Eq6 remained in stable E during its entire hospitalization. Eq7 and Eq9 was initially housed in stable D, but after testing positive for EHV-4, they were moved to the isolation unit 1 and 2, respectively. Eq8 was initially in the intensive care unit (stable A) and was moved to the isolation unit 2 when it developed clinical signs of disease. The remaining horses in stable A tested negative for EHV-4. Eq10 was initially hospitalized for minor surgery of skin tumors, and was stabled in stable D during its hospitalization. It was installed in a box where no EHV-4 positive horse had been stabled during the outbreak and one months after the last EHV-4 positive horses had left this stable. At the time of surgery of Eq10, all but one horse from the outbreak had been discharged, and the last EHV-4 infected horse was stabled in the isolation unit 1. Eq10 was discharged from the hospital three days following the surgery. When the horse was re-admitted to the hospital six days later, showing clinical signs of respiratory disease, it was stabled in isolation unit 1 upon arrival. Biosecurity was tightened during the outbreak to limit contamination and transmission. The horses were stabled in green, yellow and red zones, with different personnel for each section and in the yellow and red zone, the personnel had to wear protective clothing, that were changed between each individual horses.

Overview of different stables of the Large Animal Teaching Hospital and the location of the horses at their initial EHV-4 positive test

The figure represents a simplified overview of the different stables at the Large Animal Teaching Hospital, the true distances are not illustrated but white areas indicate that the stables are in separate buildings. Additional horses were housed in the same stables of the hospital during the outbreak, but only EHV-4 positive horses are included in this figure. “Iso1” and “Iso2” indicates the isolation units and “Out” indicates outdoor stables with open boxes to the outside. The location of Eq10 at its initial hospitalization is also included even though it was not tested for EHV-4 at this time

Until the first EHV-4 positive test results, the hospitalized horses were removed from their boxes to be examined and exercised, thereby introducing possible transmission routes. However, during the outbreak, infected or close-contact horses were only taken to an examination room in urgent circumstances and with proper disinfection and rest time after. Within the stables A, E and D the horses could have direct and indirect contact with the horses in neighboring boxes despite that the walls of the box being were around 2.5 m high, and with wooden planks separating the boxes. The outdoor boxes also had shared airspace, but with no possibility for indirect or direct contact. The boxes of the isolation units were completely separated from each other, so that the horses could not have any contact, although they still shared airspace.

Virus isolation in cells

Following four passages in the Equine dermal cells, a viral isolate was successfully obtained from Eq7 with a Ct value of 12.4 in the real-time qPCR carried out at VCM.

Analyses of the complete EHV-4 genome of the Danish outbreak strain

We successfully obtained a complete genome from the viral isolate of Eq7 accession number: OR576810 in NCBI GenBank. The raw data contained ∼ 23.000 paired end reads which after filtering and mapping remained ∼ 4700 reads with a proportion of endogenous content equal to 20.6%. After mapping and filtering the average coverage of the sample was approx. 169x (Fig. 4 A and B) with 99.87% of the genome that was covered at least 1x, 99.55% was covered 5x, 99.03% was covered 10x and 94.85% was covered 50x (Fig. 4 C). Low coverage regions (below 25x) were specifically identified in areas associated to repeated regions in the Irish reference genome and were more prevalent towards the end of the genome (Fig. 4 A). The consensus genome for Eq7 was generated and used together with one Irish, four German, eight Japanese and 14 Australian whole genome sequences to build a full genome phylogeny. The Maximum Likelihood tree was highly supported and revealed the Danish EHV-4 genome as closest to a cluster of sequences from Japan and Australia (Fig. 4 D). The number of nucleotide dissimilarity between our sample (OR576810_EHV4_Eq7_Denmark) and the rest of the full genome sequences in the dataset ranged from 348 to 782 bases with the highest sequence identity to Equid alphaherpesvirus 4 isolate 405 − 76 from Australia (NCBI Genbank accession number: KT324740).

Genomic characterization of Eq7

( A ) Depth distribution across the genome. ( B ) Violin plot showing the average depth of coverage. ( C ) Plot showing the breadth of coverage at 1x, 5x, 10x, 50x and 100x. The red dotted line represents a threshold of 99%. ( D ) Maximum likelihood tree based on the whole genome sequencing data from the sample Eq7 and the 27 reference sequences available from NCBI Genbank. The bootstrap support is shown at the base of each node. The accession number of each reference sequence is indicated in the taxon

Analyses of the partial ORF30 sequences

In total, 2870 nts of the ORF30 were successfully obtained from three of the EHV-4 infected horses including Eq7 (accession number OR532440), Eq8 (accession number OR532439) and Eq10 (accession number OR532441). Subsequently, a pairwise comparison was performed including the three partial ORF30 sequences. The results of this sequence comparison revealed that the ORF30 of two of the horses Eq7 and Eq8 were 100% identical, whereas the sequence of Eq10 showed six nucleotide differences compared to Eq7 and Eq8. The partial ORF30 sequences were also compared to two German reference sequences obtained from another outbreak. These two German sequences were also 100% identical to each other, while only four nucleotide differences were observed to Eq7 and Eq8 and six nucleotide differences were found to Eq10 (Fig. 5 ).

Characterization of the partial ORF30 sequences of Eq7, Eq8 and Eq10

Pairwise distance plot of the three partial ORF30 EHV-4 sequences obtained from the three Danish horses (Eq7, Eq8 and Eq10) and two selected German reference sequences with the NCBI Genbank accession numbers: MW892436 and MW892438. The bottom section of the plot shows the count of nucleotide differences while the upper part shows the percentage of identity among the sequences

Discussion and conclusions

Although EHV-4 is widespread and enzootic circulating in horses globally, there is very few published studies on outbreaks linking viral transmission and excretion with clinical signs. In the present report, we describe an outbreak of EHV-4 in a large university hospital. The data collected are unique in the sense that both nasal swab and blood samples were available from all horses also before the first horse tested positive, detailed clinical examinations were performed on a daily basis and the hospital recorded the housing and movement of horses during the full course of the outbreak.

On average, the EHV-4 infected foals and horses included in this study tested PCR positive on nasal swabs for viral DNA for approximately 17 days. This is in accordance with recent studies showing that 75% of EHV-4 infected foals shed viral DNA in nasal secretion for two to four weeks, measured by PCR in nasal swabs [ 4 , 8 ]. Results from the present study found that only one serum sample tested weakly positive for EHV-4 virus, which is in accordance with a study showing that EHV-4 could only be detected in low concentration in peripheral blood leukocytes in the early state of infection compared to the amount of virus detected in nasal swabs [ 10 ].

A previous study showed that detection of EHV-4 mRNA as a measure of active replication correlated well with both clinical signs and detection of high levels of EHV-4 DNA and lasted for approximately 7 days [ 10 ], and EHV-4 could be isolated in cell culture for up to three days after experimental infection [ 13 ]. None of these methods can precisely predict the period where infected horses can transmit the virus on to other horses as the PCR tests can pick of reminiscence of non-infectious viral RNA and the detection limit of the cell culture isolations is probably above the infectious dose. Furthermore, the infectious dose will depend on a variety of individual host -and environmental factors. Nevertheless, based on findings from the present study, the epidemiological information and results of previous studies it is reasonable to estimate that on average an infected horse may transmit the virus on to other susceptible horses 2–9 days after infection, but with significant individual differences. As observed in previous studies, the EHV-4 infected horses of the Danish outbreak presented with clinical signs such as anorexia, pyrexia, mandibular lymphadenopathy, coughing and nasal discharge [ 4 , 6 , 7 ]. The majority of the ten horses showed nasal discharge, lymphadenopathy and increased lung sounds and 8/10 horses were either subfebrile or had pyrexia during their infection. An additional observation in this Danish outbreak, was that 50% of the horses also had ocular discharge, which was also reported by an American study [ 13 ].

The four most severely affected horses were between 11 months and two years of age with the exception of one horse being 7 years old. All had a low EHV-4 pre-infection antibody levels. On the contrary, the horses classified as subclinical to mildly affected were all above ten years old. Five of the ten infected horses in the Danish outbreak were younger than one year of age which in in accordance with previous studies finding that foals less than one year are more often infected [ 4 , 8 , 14 ]. This indicate that both age and the immune status at the time of infection plays an important role in the severity of disease. The three horses that were EHV-4 naïve upon arrival at the hospital were all ≤ 1 year old, thereby making it likely that they did not encounter EHV-4 before. Two of the three antibody negative horses seroconverted after the EHV-4 infection, whereas the third horse remained seronegative, probably because the last available blood sample was obtained only eight days following the first EHV-4 positive test, which may be before a detectable antibody response can be detected. An increase in OD-value was observed in five out of six horses, from which a post-infection serum sample was obtained. The majority of the post-infection sera was obtained two-three weeks after the first EHV-4 positive nasal swab. Interestingly an 81 days post-infection serum sample from Eq7 was obtained with no significant decrease in the OD-value compared to the sample taken 66 days earlier.

Based on the viral detections, antibody responses, clinical registrations, stable locations and horse movement it was possible to identity Eq1 as a potential “patient zero” of the outbreak. Only two horses, Eq1 and Eq9, had high levels of EHV-4 antibody titer at arrival to the hospital, indicating that they could have had an active EHV-4 infection or re-activation of latent EHV-4 virus due to stress induced by recent disease, transportation and/or hospitalization. Re-activation is known to cause a boost of prior EHV-4 antibody response resulting in the high antibody levels observed [ 15 ]. As Eq9 was hospitalized several days after the first three confirmed EHV-4 cases this horse was ruled out as patient zero.

The first horses to present with EHV-4 positive nasal swabs and clinical signs of disease were Eq1, Eq2 and Eq3 Eq2 and Eq3 were both negative for EHV-4 antibodies at arrival to the hospital, however, a rise in antibodies post infection is not measurable until 8–10 days after infection [ 14 ]. Eq2 and/or Eq3 could therefore possibly have been infected shortly before being hospitalized and can thereby not be entirely ruled out as patient zero. Nevertheless, the fact that Eq1 were among the first to show clinical signs combined with its antibody positive status point at this horse being patient zero. Noteworthy is also that Eq6 also showed clinical signs of disease at an early point and had a relatively high level of antibodies at arrival at the hospital, however, this horse was not tested until a week after the three first confirmed EHV-4 cases. Interestingly, Eq6 originated from the same premise as Eq1, and the two horses were transported and admitted to the hospital together.

Five out of ten horses were stabled in stable E, the location of two of the first EHV-4 positive horses, possible creating a high-risk environment for transmission both by direct contact trough aerosols [ 16 ] or indirect contact such as personal, use of the same equipment, examination rooms and feeding trucks. The persistence of EHV-4 in the environment has not previously been reported, but it has been shown that EHV-1 can persist for up to 48 h [ 17 ] and for three weeks in water [ 18 ].

Eq10 was admitted to the hospitalized two months after the beginning of the EHV-4 outbreak at a time where only one EHV-4 infected horse was present in the isolation unit. Results of the partial ORF30 sequencing of the strain from Eq7 and Eq8 only showed 99.79% sequence identity to that of Eq10, equal to the genetic difference between German, Australian and Japanese sequences (Pavulraj et al. 2021) indicating that Eq10 was infected with another EHV-4 strain than the one related to the outbreak (Fig. 5 ). This in turn indicate that the internal biosecurity measures at the hospital were able to eliminate the outbreak virus. The presence of different EHV-4 strains within a short period indicate that EHV-4 is enzootic and stress the importance of biosecurity in equine hospital facilities where several horses are housed together, have co-morbidities and high stressors that can re-activate a latent EHV-4 infection. In the present study, the three initially infected horses were also positive for co-infections with EHV-5 and Streptococcus Equi subsp. Zooepidemicus. Both pathogens are known commensals, but can potentially enhance disease [ 6 , 9 , 19 ]. Interestingly, the three horses with the co-infection belonged to the moderately or severely clinically affected groups. A recent study by Pusterla et al. found that 20% of EHV-4 infected horses were co-infected with one or multiple of the following pathogens: Equine Influenza virus, Streptococcus Equi subsp. Equi and Equine Rhinitis virus [ 6 ] but the horses of that study were not tested for Streptococcus Equi subsp. Zooepidemicus or EHV-5.

Interestingly, the full genome sequence of the EHV-4 virus isolated from Eq7, revealed a higher level of sequence identity to EHV-4 strains from Australia and Japan, than to other European EHV-4 sequences available from Germany (Fig. 4 ). Since very few full genome EHV-4 sequences are available for comparison these results should be interpreted with caution. More global EHV-4 sequences are needed to be able to analyze local clustering and exchanges of EHV-4 viruses.

Study design

Included in the study were nine horses (mean age of five years), that were all part of an EHV-4 outbreak at a referral hospital in Denmark. The exact age and additional information are available in Additional File 2 . Inclusion criteria was a minimum of one EHV-4 positive nasal swab analyzed by the commercial laboratory Laboklin, Germany. Horses hospitalized during the outbreak and tested negative for EHV-4 were not included in the study.

The “outbreak period” defined as the period from the first horse tested EHV-4 positive (27th of April) until the last EHV-4 positive horse was discharged after testing negative lasted for a total of seven weeks (17th of June 2022) with the last test positive horse testing positive June 10th 2022. The given dates indicate the collection day of the nasal swab that later tested positive in the laboratory. Horses displaying clinical signs compatible with EHV-4, and close-contacts of infected horses, were all tested by nasal swabs send for analysis at a commercial laboratory. Isolation of EHV-4 positive horses and close-contact horses was initiated following the American Association of Equine Practitioners (AAEP) Biosecurity Guidelines [ 20 ]. In addition, all EHV-4 positive horses were tested continuously until they tested negative. A selection of these samples was also tested at the Section of Veterinary Clinical Microbiology at the University of Copenhagen (VCM). Clinical files, stable/box locations and paraclinical test results were included from the infected horses.

An additional horse, Eq10, initially hospitalized from the 15th -18th of June 2022 and re-admitted to the isolations facilities on June 24th 2022 due to pyrexia was also included into the study, as it tested positive for EHV-4 on the 27th of June 2022. The clinical file and samples similar to the once described above was included for this horse. Additional file 4 describe the complete sample list.

Nasal swab for PCR

Nasal swabs for analyses at a commercial laboratory were obtained by the use of 15 cm long dry swabs (Kruuse, Denmark), passed as far as possible into the nasopharynx by the ventral meatus and rotated for 15–30 s. The swabs were inserted into an empty sterile container and kept in a refrigerator until being shipped and analyzed by the laboratory. The first samples were tested for a number of respiratory pathogens including: EHV-1, EHV-5, Streptococcus Equi subsp. Zooepidemicus and Streptococcus Equi subsp. Equi, Coronavirus and Influenza A, whereas the last samples were tested solely for the presence of EHV-4 by real time PCR. The time span between sampling and test results was approximately 3 working days. In addition to the nasal swabs obtained and analyzed by the commercial laboratory during the outbreak, additional nasal swabs (Medical Wire, Corsham, UK) were collected from the EHV-4 positive horses, for analysis at VCM. The swabs were subsequently immersed in Sigma Virocult Media (Medical Wire) and stored at minimum − 20 °C until further analysis. In total, 28 nasal swabs were tested at VCM, which together with the results of the nasal swabs tested at Laboklin ( n = 38) equaled 66 qPCR results on EHV-4 detection from the ten horses.

Clinical findings

Each horse was clinically examined at least once daily. The following data was extracted from the files: rectal temperature, palpation of the mandibular lymphnodes (size and painfulness), the presence or not of nasal discharge (colour and viscocity), the presence of cough (yes/no), lung auscultation (normal/abnormal) and the presence or not of ocular discharge.

Serum sample collection, storage, and handling

Serum samples were routinely drawn from all horses at admittance and on indication during the stay. Samples were stored at -20 C. All possible serum samples obtained from the ten outbreak horses were included ( n = 26) with the aim of obtaining one pre-infection and at least one post-infection serum sample from each horse.

Extraction of DNA

The DNA extraction of the 28 nasal swab samples analyzed at VCM laboratory was performed using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) automated on the QIAcube connect (QIAGEN), according to manufacturer’s protocol [ 16 ]. The DNA of the serum samples and the viral isolate were extracted manually using the same extraction kit.

Real time qPCR

The extracted DNA was subsequently used in a previously published real-time qPCR targeting the glycoprotein B of EHV-4 [ 8 ]. In brief, 20 𝜇 L of reaction mix (Sensifast No-Rox (2x), primers (EHV4-F: CGCAGAGGATGGAGACTTTTACA and EHV4-R: CATGACCGTGGGGGTTCAA) and probe (EHV4-P: FAM-CTGCCCGCCGCCTACTGGATC-TAM)) was mixed with 5 𝜇 L of DNA and analyzed on the Rotor-gene Q machine (QIAGEN) using the following program: 95 °C for 2 min, 40 × (95 °C for 3 s and 60 °C for 60 s (acquire on green channel)) and 60 °C for 60 s. The raw data was analyzed using the following settings: cycle threshold (Ct) 0.02, ignore the first cycle, using dynamic tube, slope correct, and an outlier removal of 10%. A positive and a negative control were included in all runs, and all samples were analyzed in duplicates.

The serum samples obtained were tested at the VCM laboratory for the presence of EHV-4 antibodies using a commercial ELISA [ 17 ] able to differentiate between EHV-1 and EHV-4 antibodies. As mentioned, the samples were selected to obtain minimum one pre- and one post-infection sample, with the post infection sample being as far in time from the first EHV-4 positive test as possible. The commercial kit was the Svanovir ® EHV1/EHV4-Ab kit (Svanova, Uppsala, Sweden), which is an indirect ELISA based on type-specific recombinant glycoprotein G fusion protein. The preparation of reagents and the ELISA procedure were performed according to the instruction manual [ 17 ]. A corrected OD value of > 0.2 was regarded as positive, whereas a corrected OD value < 0.1 was regarded as negative and a corrected OD value of 0.1–0.2 were considered as doubtful.

Equine Dermal cells, NBL-6 (ATCC, Denmark) was cultivated using MEM (Gibco, Termofisher Scientific, Roskilde, Denmark), Non-Essential Amino Acids (Merck, Darmstadt, Germany), Na-Pyruvate 100mM (Gibco, Termofisher Scientific), Penicillin-Streptomycin-Neomycin (PSN) Antibiotic Mixture (Termofisher Scientific) and 10% Fetal Calf Sera. At 100% confluence, the cells were inoculated with 200 𝜇 L nasal swab sample of Eq7 that was first sterile filtrated using 0.45 𝜇 m Minisart NML Plus Surfactant-free Cellulose Acetate Syringe Filters (Sartorius, Göttingen, Germany). The cells and the supernatant were passaged using 0.05% Trypsin-EDTA (Gibco, Termofisher Scientific) four times adding 1/5 new cells in each passage in a larger cell flasks. At each passage 200 𝜇 L of cells were harvested and subjected to the DNA extraction and the real-time qPCR described above in order to determine if the viral isolation had been successful.

Next-generation sequencing (NGS)

The supernatant and the cells of the fourth passage were harvested and centrifuged at 3000 RPM for 15 min to remove cellular debris. Thereafter the supernatant was subjected to ultracentrifugation at 25.000RPM for one hour at 4 0 C. The pellet containing the virions were then disrupted using 200μL PBS, and the DNA extracted manually using the DNA Purification protocol “Blood or Body Fluid“ of the QIAamp DNA mini kit (QIAGEN). The extracted DNA was used as input for the Nextera XT library prep protocol, and the samples were sequenced using the Illumina MiSeq platform (Statens Serum Institut, Copenhagen S, Denmark).

Analysis of the NGS data

Illumina raw reads from the isolate of Eq7 were filtered using fastp v0.20.1 [ 18 ] to filter out low complexity reads and with quality below 25. The filtered reads were then aligned to the German reference genome (MW892436) using bwa v0.7.17 [ 21 , 22 ] and potential duplicates were identified and removed using picard MarkDuplicates v2.27.2 ( http://broadinstitute.github.io/picard ). Samtools v1.16.1 [ 23 ] was then used to sort and index the bam file and to determine the read coverage along the whole genome. The consensus genome was generated using bcftools mpileup and bcftools call v1.14 [ 23 ]. Genomic position with read coverage below 5x were assigned as missing site “N”.

The consensus sequence was concatenated with the 27 full reference genomes retrieved from NCBI from Australia, New Zealand, Germany, Ireland and Japan (NCBI Genbank accession numbers: AF030027, KT324741, KT324740, KT324743, KT324746, KT324745, KT324744, KT324748, KT324736, KT324738, KT324739, KT324747, KT324742, KT324735, KT324737, MW892435, MW892436, MW892437, MW892438, LC075586, LC063142, LC075587, LC075582, LC075585, LC075584, LC075588 and LC075583).

The sequences were aligned using mafft v7.486 [ 24 ] and trimAl v1.4 [ 25 ] with a gap threshold of 95% and a conservation percentage of minimum 60% (-gt 0.95 -cons 60) was used to remove gaps related to highly repetitive regions. A pairwise comparison and a maximum likelihood phylogenetic tree of the full genome data was generated with IQ-TREE v2.1.2 [ 26 ] with the option -m TEST to calculate the best evolutionary model for the alignment using ModelFinder [ 27 ] and 1000 bootstrap replicates.

PCR amplification of ORF30

For other EHV-4 samples, it was not possible to obtain an isolate, and therefore conventional PCR amplification of ORF30 was performed. Four primer-pairs previously published for ORF30 were used [ 4 ], along with the Accuprime Taq High Fidelity kit (Termo Fisher Scientific, Denmark). Four different PCR programs were applied for each primer pair (see Additional File 5 ). The resulting PCR products were visualized using the Invitrogen E-gel 1% SYBR Safe agarose gel, Termo Fisher Scientific and purified using the High Pure PCR Product Purification Kit, Roche, Basel, Switzerland. The PCR products were used as input for the Nextera XT library prep protocol, and the samples were sequenced using the Illumina MiSeq (Statens Serum Institut, Copenhagen S).

Analysis of the ORF30 sequencing data

The data from the next-generation sequencing (NGS) was analyzed using the CLC genomics workbench version 22.0.2 (QIAGEN). Fastq files were imported, and all of the reads were paired and trimmed with a quality limit of 0.2 and a maximum number of ambiguities of two. The trimmed reads were then mapped to a full-length reference genome of a recent German EHV-4 strain (accession number: MW892438). A consensus sequence of ORF30 was extracted and subsequently aligned using the MUSCLE alignment tool [ 28 ] and to the partial ORF30 derived from all EHV-4 sequences available at NCBI GenBank described above ( n = 27). Following the alignment, a “pairwise comparison” was created to examine nucleotide differences between Eq7, Eq8 and Eq10 and two German reference sequences (accession numbers: MW892436 and MW892438) derived from a single outbreak.

Data availability

All data generated or analyzed during this study are included in the article and its supplementary files.

Azab W, Kato K, Abdel-Gawad A, Tohya Y, Akashi H. Equine herpesvirus 4: recent advances using BAC technology. Vet Microbiol. 2011;150(1–2):1–14.

Article CAS PubMed Google Scholar

Badenhorst M, Page P, Ganswindt A, Laver P, Guthrie A, Schulman M. Detection of equine herpesvirus-4 and physiological stress patterns in young thoroughbreds consigned to a South African auction sale. BMC Vet Res. 2015 [cited 2023 Mar 29];11(1). /pmc/articles/PMC4450643/

Vaz PK, Horsington J, Hartley CA, Browning GF, Ficorilli NP, Studdert MJ et al. Evidence of widespread natural recombination among field isolates of equine herpesvirus 4 but not among field isolates of equine herpesvirus 1. J Gen Virol. 2016 [cited 2023 Mar 29];97(Pt 3):747. /pmc/articles/PMC5381393/

Pavulraj S, Eschke K, Theisen J, Westhoff S, Reimers G, Andreotti S et al. Equine herpesvirus type 4 (Ehv-4) outbreak in germany: virological, serological, and molecular investigations. Pathogens. 2021 [cited 2023 Mar 29];10(7). /pmc/articles/PMC8308676/

Izume S, Kirisawa R, Ohya K, Ohnuma A, Kimura T, Omatsu T et al. The full genome sequences of 8 equine herpesvirus type 4 isolates from horses in Japan. J Vet Med Sci. 2017 [cited 2023 Mar 29];79(1):206. /pmc/articles/PMC5289262/

Pusterla N, James K, Barnum S, Bain F, Barnett DC, Chappell D et al. Frequency of detection and prevalence factors associated with common respiratory pathogens in equids with acute onset of fever and/or respiratory signs (2008–2021). Pathogens. 2022 [cited 2023 Mar 29];11(7). /pmc/articles/PMC9317490/

Ma G, Azab W, Osterrieder N. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)--masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol. 2013 [cited 2023 Mar 29];167(1–2):123–34. https://pubmed.ncbi.nlm.nih.gov/23890672/

Pusterla N, Leutenegger CM, Wilson WD, Watson JL, Ferraro GL, Madigan JE. Equine herpesvirus-4 kinetics in peripheral blood leukocytes and nasopharyngeal secretions in foals using quantitative real-time TaqMan PCR. J Vet Diagn Invest. 2005 [cited 2023 Mar 29];17(6):578–81. https://pubmed.ncbi.nlm.nih.gov/16475518/

El-Hage C, Mekuria Z, Dynon K, Hartley C, McBride K, Gilkerson J. Association of equine herpesvirus 5 with mild respiratory disease in a survey of EHV1, -2, -4 and – 5 in 407 Australian horses. Anim an open access J from MDPI. 2021 [cited 2023 Mar 29];11(12). https://pubmed.ncbi.nlm.nih.gov/34944194/

Pusterla N, Mapes S, David Wilson W. Prevalence of latent alpha-herpesviruses in thoroughbred racing horses. Vet J. 2012 [cited 2023 Mar 29];193(2):579–82. https://pubmed.ncbi.nlm.nih.gov/22405721/

Cuxson JL, Hartley CA, Ficorilli NP, Symes SJ, Devlin JM, Gilkerson JR. Comparing the genetic diversity of ORF30 of Australian isolates of 3 equid alphaherpesviruses. Vet Microbiol. 2014;169(1–2):50–7.

Radalj A, Milic N, Stevanovic O, Nisavic J. The detection and phylogenetic analysis of equine herpesviruses 1, 4 and 5 identified in nasal swab samples of asymptomatic horses from Serbia and Bosnia and Herzegovina. Vet Ital. 2021 [cited 2023 Mar 29];57(4):265–74. https://pubmed.ncbi.nlm.nih.gov/35593499/

Pusterla N, Bain F, James K, Mapes S, Kenelty K, Barnett DC et al. Frequency of molecular detection of equine herpesvirus-4 in nasal secretions of 3028 horses with upper airway infection. Vet Rec. 2017 [cited 2023 Apr 3];180(24):593. https://pubmed.ncbi.nlm.nih.gov/28386031/

Sellon DC, Long MT. Equine infectious diseases. 2013.

Kydd JH, Townsend HGG, Hannant D. The equine immune response to equine herpesvirus-1: the virus and its vaccines. [cited 2023 Sep 13]; Available from: www.elsevier.com/locate/vetimm

QIAGEN. QIAamp ® DNA mini and blood mini handbook. 2016. p. 72. https://www.qiagen.com/us/resources/resourcedetail?id=62a200d6-faf4-469b-b50f-2b59cf738962&lang=en

Indical bioscience, Handbook, SVANOVIR EHV1/EHV4-Ab. 2021. https://shop.indical.com/index.php?cl=details&anid=2b05cf3ab758820ec001dd7d8813152b&force_admin_sid=o5pe7kkq49cvinffcq4tqhorg3&stoken=93014DE9&shp=1&preview=e7d04d86fd89153f68a4a3f88edf4b41

Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018 [cited 2023 Aug 4];34(17):i884–90. https://doi.org/10.1093/bioinformatics/bty560

Pusterla N, Rice M, Henry T, Barnum S, James K. Investigation of the shedding of selected respiratory pathogens in healthy horses presented for routine dental care. https://doi.org/10.1177/0898756420949135 . 2020 [cited 2023 Apr 4];37(2):88–93. https://journals.sagepub.com/doi/10.1177/0898756420949135

AAEP. General biosecurity guidelines. Guideline. 2022 [cited 2022 Apr 1]. pp. 1–17. https://aaep.org/document/general-biosecurity-guidelines

Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009 [cited 2023 Aug 4];25(14):1754–60. https://pubmed.ncbi.nlm.nih.gov/19451168/

Li H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. 2013 [cited 2023 Aug 4]; https://arxiv.org/abs/1303.3997v2

Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021 [cited 2023 Aug 4];10(2):1–4. https://doi.org/10.1093/gigascience/giab008

Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013 [cited 2023 Aug 4];30(4):772. /pmc/articles/PMC3603318/

Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009 [cited 2023 Aug 4];25(15):1972. /pmc/articles/PMC2712344/

Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015 [cited 2023 Aug 4];32(1):268–74. https://doi.org/10.1093/molbev/msu300

Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 2017 146. 2017 [cited 2023 Aug 4];14(6):587–9. https://www.nature.com/articles/nmeth.4285

Edgar CR. MUSCLE: multiple sequence alignment with high accuracy and high throughput. 2013 [cited 2019 Jun 27]; https://findit.dtu.dk/en/catalog/2354275506

Download references

Acknowledgements

We acknowledge all owners of the horses that contributed to this study.

No funding was obtained for this study.

Open access funding provided by Copenhagen University

Author information

Authors and affiliations.

Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Grønnegårdsvej 2, Frederiksberg C, DK-1870, Denmark

Pia Ryt-Hansen, Victoria Kyhl Johansen & Lars Erik Larsen

Statens Serum Institut, Artillerivej 5, Copenhagen S, 2300, Denmark

Marta Maria Cuicani

Department of Veterinary Clinical Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Taastrup, Denmark

Sanni Hansen

You can also search for this author in PubMed Google Scholar

Contributions

P.R.H. designed the overall study, analyzed the results and drafted the final manuscript. V.K.J carried out the laboratory analysis of the nasal swabs and serum samples, obtained the clinical journals, analyzed the results and contributed to the final manuscript. M.M.C. carried out the sequencing, sequencing analysis, analyzed the results and approved the final manuscript, L.E.L. helped in the design of the overall study and contributed to the final manuscript and S.H. designed the overall study, analyzed the results and contributed to the final manuscript.

Corresponding author

Correspondence to Pia Ryt-Hansen .

Ethics declarations

Ethics approval and consent to participate.

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been followed and the appropriate ethical review committee approval has been received. The study was approved by the Ethical Committee of the Department of Veterinary Clinical Sciences, University of Copenhagen (permit #2020-014). In addition, all methods were performed in accordance with the relevant guidelines and regulations. Explicit owner informed consent for inclusion of samples from included horses in this study was not sought but owners were aware that excess material from clinical samples would be retained for research; in general, and all owners have the option to opt out of research. In addition, all samples and clinical journals were handled anonymously.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary material 2, supplementary material 3, supplementary material 4, supplementary material 5, rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Ryt-Hansen, P., Johansen, V.K., Cuicani, M.M. et al. Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization. BMC Vet Res 20 , 287 (2024). https://doi.org/10.1186/s12917-024-04149-x

Download citation

Received : 22 September 2023

Accepted : 19 June 2024

Published : 03 July 2024

DOI : https://doi.org/10.1186/s12917-024-04149-x

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Equine herpesvirus 4
Patient zero
Full genome sequencing
Respiratory disease
Biosecurity

BMC Veterinary Research

ISSN: 1746-6148

General enquiries: [email protected]

Information

Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

Active Journals
Find a Journal
Proceedings Series
For Authors
For Reviewers
For Editors
For Librarians
For Publishers
For Societies
For Conference Organizers
Open Access Policy
Institutional Open Access Program
Special Issues Guidelines
Editorial Process
Research and Publication Ethics
Article Processing Charges
Testimonials
Preprints.org
SciProfiles
Encyclopedia

Article Menu

Subscribe SciFeed
Recommended Articles
Google Scholar
on Google Scholar
Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Investigating large-scale tuned liquid dampers through real-time hybrid simulations, 1. introduction, 2. objectives, 3. real-time hybrid-simulation experimental setup, 3.1. methodology: real-time hybrid simulation (rths), 3.2. mechanical setup for tests, 3.3. real-time hybrid simulator, 3.4. software, 3.5. ground motions, 3.6. analytical and experimental substructures, 4. rths of linear/nonlinear sdof equipped with large-scale tld subjected to seismic loading, 5. linear substructure results, 6. nonlinear substructure results, 7. summary and conclusions, author contributions, data availability statement, acknowledgments, conflicts of interest.

Xu, Y.; Chen, B. Integrated vibration control and health monitoring of building structures using semi-active friction dampers: Part I—Methodology. Eng. Struct. 2008 , 30 , 1789–1801. [ Google Scholar ] [ CrossRef ]
Fujino, Y.; Pacheco, B.M.; Chaiseri, P.; Sun, L.M. Parametric studies on tuned liquid damper (TLD) using circular containers by free-oscillation experiments. Doboku Gakkai Ronbunshu 1988 , 5 , 381–391. [ Google Scholar ] [ CrossRef ]
Tamura, Y.; Fujii, K.; Sato, T.; Wakahara, T.; Kosugi, M. Wind-induced vibration of tall towers and practical applications of tuned sloshing dampers. In Proceedings of the Workshop on Serviceability of Buildings (Movements, Deformations, Vibrations), Ottawa, ON, Canada, 16–18 May 1988. [ Google Scholar ]
Shen, K.; Soong, T.; Chang, K.; Lai, M. Seismic behavior of reinforced concrete frame with added visco-elastic dampers. En-Gineering Struct. 1995 , 17 , 372–380. [ Google Scholar ] [ CrossRef ]
Ghabraie, K.; Chan, R.; Huang, X.; Xie, Y.M. Shape optimization of metallic yielding devices for passive mitigation of seismic energy. Eng. Struct. 2010 , 32 , 2258–2267. [ Google Scholar ] [ CrossRef ]
Zhang, Y.; Zhu, S. A shape memory alloy-based reusable hysteretic damper for seismic hazard mitigation. Smart Mater. Struct. 2007 , 16 , 1603–1613. [ Google Scholar ] [ CrossRef ]
Ni, Y.; Chen, Y.; Ko, J.; Cao, D. Neuro-control of cable vibration using semi-active magneto-rheological dampers. Eng. Struct. 2003 , 24 , 295–307. [ Google Scholar ] [ CrossRef ]
Yang, G.; Spencer, B.; Carlson, J.; Sain, M. Large-scale MR fluid dampers: Odeling and dynamic performance considerations. Eng. Struct. 2002 , 24 , 309–323. [ Google Scholar ] [ CrossRef ]
Chen, Y.; Hwang, W.; Chiu, L.; Sheu, S. Flexibility of TLD to high-rise building by simple experiment and comparison. Comput. Struct. 1995 , 57 , 855–861. [ Google Scholar ] [ CrossRef ]
Kim, Y.-M.; You, K.-P.; Ko, N.-H.; Yoon, S.-W. Use of TLD and MTLD for control of wind-induced vibration of tall buildings. J. Mech. Sci. Technol. 2006 , 20 , 1346–1354. [ Google Scholar ] [ CrossRef ]
NatHaz Research. tuned Liquid Dampers (TLDs) and Tuned Liquid Column Dampers (TLCDs) Research at NatHaz Modeling Laboratory. Available online: https://nathaz.nd.edu/research/liquid/liq_damp.html (accessed on 30 May 2024).
Reed, D.; Yu, J.; Yeh, H.; Gardarsson, S. Investigation of Tuned Liquid Dampers under Large Amplitude Excitation. J. Eng. Mech. 1998 , 124 , 405–413. [ Google Scholar ] [ CrossRef ]
Sun, L.M.; Fujino, Y.; Pacheco, B.M.; Chaiseri, P. Modelling of tuned liquid damper (TLD). J. Wind Eng. Ind. Aerodyn. 1992 , 43 , 1883–1894. [ Google Scholar ] [ CrossRef ]
Yu, J.; Wakahara, T.; Reed, D.A. A non-linear numerical model of the tuned liquid damper. Earthq. Eng. Struct. Dyn. 1999 , 28 , 671–686. [ Google Scholar ] [ CrossRef ]
Banerji, P.; Murudi, M.; Shah, A.; Popplewell, N. Tuned liquid dampers for controlling earthquake response of structures. Earthq. Eng. Struct. Dyn. 2000 , 29 , 587–602. [ Google Scholar ] [ CrossRef ]
Kosaka, H.; Noji, T.; Yoshida, H.; Tatsumi, E.; Yamanaka, H.; Agrawal, A. Damping effects of a vibration control damper using sloshing of water. In Proceedings of the 10th World Conference on Earthquake Engineering, Madrid, Spain, 19–24 July 1992. [ Google Scholar ]
Xiao, C.; Wu, Z.; Chen, K.; Tang, Y.; Yan, Y. An experimental study on the equivalent nonlinear model for a large-sized tuned liquid damper. J. Build. Eng. 2023 , 73 , 106754. [ Google Scholar ] [ CrossRef ]
Ocak, A.; Nigdeli, S.M.; Bekdaş, G.; Kim, S.; Geem, Z.W. Adaptive Harmony Search for Tuned Liquid Damper Optimization under Seismic Excitation. Appl. Sci. 2022 , 12 , 2645. [ Google Scholar ] [ CrossRef ]
Tang, Z.; Sheng, J.; Dong, Y. Effects of tuned liquid dampers on the nonlinear seismic responses of high-rise structures using real-time hybrid simulations. J. Build. Eng. 2023 , 70 , 106333. [ Google Scholar ] [ CrossRef ]
Malekghasemi, H.; Ashasi-Sorkhabi, A.; Ghaemmaghami, A.R.; Mercan, O. Experimental and numerical investigations of the dynamic interaction of tuned liquid damper–structure systems. J. Vib. Control. 2013 , 21 , 2707–2720. [ Google Scholar ] [ CrossRef ]
Novo, T.; Varum, H.; Teixeira-Dias, F.; Rodrigues, H.; Falcao-Silva, M.; Cost, A.; Guerreiro, L. Tuned liquid dampers simula-tion for earthquake response control of buildings. Bull. Earthq. Eng. 2013 , 12 , 1007–1024. [ Google Scholar ] [ CrossRef ]
Rai, K.; Reddy, G.; Venkatraj, V. Tuned liquid sloshing water damper: A robust device for seismic retrofitting. Int. J. Environ. Sci. Dev. Monit. 2013 , 4 , 36–44. [ Google Scholar ]
Shad, H.; Bin Adnan, A.; Behbahani, H.P. Performance Evaluation of Tuned Liquid Dampers on Response of a SDOF System Under Earthquake Excitation and Harmonic Load. Res. J. Appl. Sci. Eng. Technol. 2013 , 6 , 3018–3021. [ Google Scholar ] [ CrossRef ]
Wang, J.-T.; Gui, Y.; Zhu, F.; Jin, F.; Zhou, M.-X. Real-time hybrid simulation of multi-story structures installed with tuned liquid damper. Struct. Control Health Monit. 2015 , 23 , 1015–1031. [ Google Scholar ] [ CrossRef ]
Jin, Q.; Li, X.; Sun, N.; Zhou, J.; Guan, J. Experimental and numerical study on tuned liquid dampers for controlling earth-quake response of jacket offshore platform. Mar. Struct. 2007 , 20 , 238–254. [ Google Scholar ] [ CrossRef ]
Ghaemmaghami, A.; Kianoush, M.; Mardukhi, J. Numerical study on annular tuned liquid dampers for controlling the re-sponse of wind towers subjected to seismic loads. In Proceeding of the 15th World Conference on Earthquake Engineering, Lisbon, Portugal, 24–28 September 2012. [ Google Scholar ]
Ghaemmaghami, A.R.; Kianoush, R.; Mercan, O. Numerical modeling of dynamic behavior of annular tuned liquid dampers for the application in wind towers under seismic loading. J. Vib. Control 2015 , 22 , 3858–3876. [ Google Scholar ] [ CrossRef ]
Zhu, F.; Wang, J.; Jin, F.; Altay, O. Real-time hybrid simulation of single and multiple tuned liquid column dampers for con-trolling seismic-induced response. In Proceedings of the 6th International Conference on Advances in Experimental Structural Engineering, Illinoi, IL, USA, 19–21 October 2015. [ Google Scholar ]
Das, S.; Choudhury, S. Seismic response control by tuned liquid dampers for low-rise RC frame buildings. Aust. J. Struct. Eng. 2017 , 18 , 135–145. [ Google Scholar ] [ CrossRef ]
Zhu, F.; Wang, J.-T.; Jin, F.; Lu, L.-Q.; Gui, Y.; Zhou, M.-X. Real-time hybrid simulation of the size effect of tuned liquid dampers. Struct. Control Health Monit. 2017 , 24 , e1962. [ Google Scholar ] [ CrossRef ]
Ashasi-Sorkhabi, A.; Mercan, O. Development, Implementation, and Verification of a User Configurable Platform for Re-al-time Hybrid Simulation. Smart Struct. Syst. 2014 , 14 , 1151–1172. [ Google Scholar ] [ CrossRef ]
Ashasi-Sorkhabi, A. Implementation, Verification and Application of Real-Time Hybrid Simulation. ProQuest Dissertations & Theses, University of Toronto, Toronto, ON, Canada, 2015. [ Google Scholar ]
Lee, S.-K.; Park, E.C.; Min, K.-W.; Lee, S.-H.; Chun, L.; Park, J.-H. Real-time hybrid shaking table testing method for the per-formance evaluation of a tuned liquid damper controlling seismic response of building structures. J. Sound Vi-Bration 2006 , 302 , 596–612. [ Google Scholar ] [ CrossRef ]
Banerji, P. Tuned Liquid Dampers for Control of Earthquake Response. In Proceedings of the 13th World Conference on Earthquake Engineering, Vancouver, BC, Canada, 1–6 August 2004. [ Google Scholar ]
Ruiz, R.; Taflanidis, A.; Lopez-Garcia, D. Characterization and design of tuned liquid dampers with floating roof considering abitrary tank cross-sections. J. Sound Vib. 2016 , 368 , 36–54. [ Google Scholar ] [ CrossRef ]
Mahin, S.; Shing, P. Pseudodynamic method for seismic testing. J. Struct. Eng. (ASCE) 1985 , 111 , 1482–1503. [ Google Scholar ] [ CrossRef ]
Dermitzakis, S.; Mahin, S. Development of Substructuring Techniques for On-Line Computer Controlled Seismic Performance Testing ; Report UBC/EERC-85/04; Earthquake Engineering Research Center: Berkeley, CA, USA, 1985. [ Google Scholar ]
Nakashima, M.; Kato, H.; Takaoka, E. Development of real-time pseudodynamic testing. Earthq. Eng. Struct. Dyn. 1995 , 21 , 79–92. [ Google Scholar ] [ CrossRef ]
Horiuchi, T.; Inoue, M.; Konno, T.; Namita, Y. Real-time hybrid experimental system with actuator delay compensation and its application to a piping system with energy absorber. Earthq. Eng. Struct. Dyn. 1999 , 28 , 1121–1141. [ Google Scholar ] [ CrossRef ]
Mercan, O.; Ricles, J. Experimental Studies on real-time pseudodynamic (PSD) and hybrid PSD testing of structures with elastomeric dampers. J. Struct. Eng. 2009 , 135 , 1124–1133. [ Google Scholar ] [ CrossRef ]
Ashasi-Sorkhabi, A.; Malekghasemi, H.; Mercan, O. Implementation and verification of real-time hybrid simulation (RTHS) using a shake table for research and education. J. Vib. Control 2012 , 21 , 1459–1472. [ Google Scholar ] [ CrossRef ]
Christenson, R.; Lin, Y.Z.; Emmons, A.; Bass, B. Large-Scale Experimental Verification of Semiactive Control through Real-Time Hybrid Simulation. J. Struct. Eng. 2008 , 134 , 522–534. [ Google Scholar ] [ CrossRef ]
Ashasi-Sorkhabi, A.; Mercan, O. Experimental investigations of large scale TLD-structure interaction via real-time hybrid simulation. In Proceedings of the Resilient Infrastructure, CSCE, London, ON, Canada, 1–4 June 2016. [ Google Scholar ]

Click here to enlarge figure

#	Ground Motion	Magnitude	Location	Distance (km)	PGA (g)	Duration (s)
EQ1	Erzincan Turkey 1992	6.69	95 Erzincan	8.97	0.496	20.78
EQ2	Nahanni Canada 1985	6.76	6095 site 1	6.8	2.0508	20.56
EQ3	Kocaeli Turkey 1999	7.51	Duzce	98.22	0.312	27.185
EQ4	Duzce Turkey 1999	7.14	Bolu	41.27	0.728	55.9
EQ5	Chi-Chi Taiwan 1999	7.62	CHY028	32.67	0.822	90
EQ6	Imperial Valley 1940	6.95	El Centro, Array 09	12.99	0.3129	40.00
EQ7	Northridge 1994	6.69	Simi Valley-Katherine	12.18	0.8774	24.99

Net Length (mm)	Net Width (mm)	TLD Height (mm)	TLD MASS (kg)	Height of Water (mm)	Water Mass (kg)	Sloshing Frequency (Hz)
1978	779	1200	125	300	462	0.418

Case #	M (kg)	K (N/m)	C (N.s/m)	Linear or Nonlinear	Vy N	MR %
1	46,200	318,660	4853.4	Linear	///	1
2	15,400	106,220	1617.8	Linear	///	3
3	9240	63,732	970.67	Linear	///	5
4	46,200	318,660	4853.4	Nonlinear	17,526	1
5	15,400	106,220	1617.8	Nonlinear	5842.1	3
6	9240	63,732	970.67	Nonlinear	3505.2	5

The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

Ashasi Sorkhabi, A.; Qiu, B.; Mercan, O. Investigating Large-Scale Tuned Liquid Dampers through Real-Time Hybrid Simulations. Buildings 2024 , 14 , 2017. https://doi.org/10.3390/buildings14072017

Ashasi Sorkhabi A, Qiu B, Mercan O. Investigating Large-Scale Tuned Liquid Dampers through Real-Time Hybrid Simulations. Buildings . 2024; 14(7):2017. https://doi.org/10.3390/buildings14072017

Ashasi Sorkhabi, Ali, Barry Qiu, and Oya Mercan. 2024. "Investigating Large-Scale Tuned Liquid Dampers through Real-Time Hybrid Simulations" Buildings 14, no. 7: 2017. https://doi.org/10.3390/buildings14072017

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

Log in or Sign up

Fixed internally unable to claim researched mount.

Discussion in ' Resolved ' started by Giavannia , Dec 3, 2023 .

Giavannia New Member

I have researched the 1st mount in in zimarra and it says completed and will let me click on the claim button, but nothing happens, and it does not complete? This is from the Mount researcher Rusqik in Sanctuary.

Rushd Active Member

Myself and another Guildy having same problem. When hitting the claim button it forced the entire interface for that researcher to go dark grey and locked the scroll wheel. Updated Darq as well as Default UI's both had the same results. Then I thought to try equipping current expac mounts one by one and tried a fresh claim on all of them (closing the researcher interface and reopening each time), still same result. I tried claiming without a mount up, same result. I even went to the status merchant, bought the Treasured mount I was researching and a Legendary one that was available but I didn't want, tried claiming with both of them and still same results. After hitting claim, the interface for that researcher just locks up. I ended up stopping my research and losing the time and reducer I applied so I can try again on a fabled mount. Guess I'll see in 7 days if it works. Status for me is precious as I spent a bunch on memorial housing and personal guilds, but I was doing my due diligence on trying to solve the problem. Interestingly enough though after I put my petition in, the status merchant went from a long list of mounts with white and greyed out options to only 2 options. Then before I logged out there were half a dozen options of just white unlocked options. Kio, SkyVenture Ascended; Koryu, Zephyfall Ascended;My unlocked no-trade shiny; Stratos Aralez Draftrider; Stratos Aralez Skyclimber; Stratos Aralez Skyvoyager.

Shwetty Active Member

Taled well-known member.

See here: https://forums.daybreakgames.com/eq2/index.php?threads/bug-researcher-rusqik-seems-bugged.613302/ This issue is because you bought a CE or PE version and upgraded your claimed mount, which automatically granted you some levels of mount research. Since you were already researching T1, it didn't cancel it or prevent you starting it, but you cannot claim it because your account is already flagged for it. You need to hit 'Stop' and move on to the correct tier mount.

elbuenomalo88 New Member

So Question. I do pay the SP for the Mount i want to research on, when i hit the start research button? Bc i finished researching Hahkuh the traveler. ( yes i bought the expensive expac with the good mount ) But i saw this one is a bit better then my so i was able to start and finish the research. then i wanted to claim it, it said i dont have enough SP for it...but now i cant even start research it bc i dont have enough SP. But first time i was able to start the research so i paid already for it but was not able to claim it bc not enough SP?:S I know you guys doing an awesome job very happy with most of the expansion. But this researching thing is very frustating even more with the insane numbers of SP u want for everything in this expansion :S So now im running still my old mount from old expansion, what frustateds me bc i dont want to go to h2s before im not using the best mount i can for this expansion...

It does not take the cost when you start research. However, you cannot start research if you can't afford to finish it.

Melkior Well-Known Member

Taled is right. So if you started it, then spent Status on other things bringing you below the total, you won't be able to claim it. I think this is so you don't pay the cost then stop it and lose all the status you paid.

Caith Developer

For anyone that has gotten into a blocked state with their research due to having a completed research that you no longer qualify, you can now right click on the researcher that has the blocked research and choose the cancel research option, this will cancel the research and you will lose all current research progress, and you will not be refunded that time, but it will allow you to start a new research that you qualify for.

IMAGES

| Results of ecological quality evaluation (EQ2) with the linear model
(a) Phase of the EQ2 correction parameter in the part-0 measurement
EverQuest II Roadmap 2023
Uncertainties introduced for equvalent dose (EQ2) vs. the α/β ratio for
Frequency characteristic analysis of R eq2 with τ changes.
Everquest 2 Best Solo Class 2022

VIDEO

IAS TOPPER'S SCAM
EQ2 News 5-4-24
EQ2: GU109 Vendor-only House Items
Edexcel A-Level Further Maths: FP1
EQ2: GU109 Researched House Item Recipes
Everquest 2's Lower Class

COMMENTS

Further Research
Collect the undeciphered notes from the table near Gallie ( 328, 190, 495 ) Copy. /waypoint 328, 190, 495. Research the notes. Scribe the Recipe: Gallie's Researched Notes. Craft 5 "Gallie's Researched Notes" (the inscribed recipe is named: Completed Notes) on an Engraved Desk (there is one located at the docks) ( 756, 26, 603 ) Copy.
Further Research :: Quests :: EverQuest II :: ZAM
Everquest II Quest Information for Further Research. Speak to Ellerith Groundspark at 332, 194, 551 Copy in Butcherblock Mountains to begin this quest. You must be a level 30+ tradeskiller. Speak to Gallie Shimmercloud next to the Highlands Outpost griffon station at 327, 189, 497 Copy; Click on the sparkling notes on the table right next to Gallie.
Further Research Required
At least 70g. Completing this quest gives +2,000 faction with City of Paineel. You'll be offered one or more of the following, depending on your class. You must choose one: Blade of Blanketed Treachery (fighter choice) Falchion of Steadfast Posture (fighter choice) Spike of Superior Reticence. Staff of Summoning Earth (fighter, shaman choice)
Further Research Required :: Quests :: EverQuest II :: ZAM
Copy. in the Hall of Wizardry. High Commander Fawzi Zaim is at 1902.13, -298.99, 3446.32. Copy. in the Hall of the Fell Blade. Nudhir Il'qatai is at 1645.60, -267.06, 3179.00. Copy. in the Hall of Necromancy. Every single one of these NPC's will offer you a quest.
List of Acquisitions for the Continuing of Research
Go to Runnyeye and kill Blikritz Bauble-eye at ( 153, -16, -117 ) Copy. /waypoint 153, -16, -117. If he is not there at the time, kill the goblins in the area and wait for a respawn. Eventually he will spawn by himself in his room. The moment Blikritz dies the quest will update and you receive an unconscious goblin.
The Sundered Frontier (EQ2 Quest Series)
Divert to the Eye of Dartain quest line from Distorted View (81) to the end of the Stonebrunt Encampment quest chain. Go to the Kerra Isle quest line at this time and return when you have completed Feathers for Peace of Heart. Investigating Strange Bones - Leads you to Jin'tu and the Kejaan's Rill quest line.
Question Regarding "Tradeskill Mission: Renewal of Ro"
Delta Field Research Requisition B. Plateaus Field Research Requisition B. Takish Field Research Requisition C. My Quest Journal shows that I have completed the above three missions, though I have completed 6 total Research Missions. Also, I have seen in the Forums that people have completed all of the required missions for flight in one to two ...
EverQuest II: A reference
The EverQuest II discord. A discord server frequented by developers and designers, as well as many players. A handy place to find information and ask questions. Tradeskill timeline. A list and guide for all of the main tradeskill questlines in the game. RoR guide for returning players.
Getting Started in Ballads of Zimara
Suggested Things to do before starting your adventure, these will make your journey to 130 and beyond easier: Finish the 2023 Panda, Panda, Panda Quests. Complete the Legend Hunting achievement on the Kael Drakkel Server. Obtain a Handcrafted Zimaran Hackamore of Status and a Mastercrafted Zimaran Ring.
Ten Ton Hammer
EQ2 menu, choose Alternate Advancements then use the slider to determine how. much of your adventure experience to convert into achievement experience. This. is particularly helpful for those who wish to build their achievement experience. and are less concerned about gaining adventure levels.
Research (EQ2) :: Wiki :: EverQuest II :: ZAM
Research Assistant NPCs became obsolete with an update on 12/7/2010. To research, access the "Research" tab in your Knowledge book. (default hotkey is "K") The researchers are currently offering their services to upgrade your spells and combat arts. Players are unable to research an ability until they obtain level 20.
Research
Research is a pretty inconsistant Tradeskill on TLP's. 243 is going to be the max you can get Research for a while on a new TLP until you can create PoP spells, which takes place 3 expansions after PoP. This is a patch note from back in 2017: As of 10/18/21 I received some feedback that the patch note appears to refer to Researchable spells PoP+.
Why is Everquest 2 so despised, especially in the Everquest 1 ...
EQ2 homes can be immense .. in fact, you can own an entire tropical island .. and allow decorating inside and out. You can build homes from the ground up, using special home building tools, and one character can own several homes. Tradeskills are also great in EQ2, worlds better than they were in EQ1, which was a bit of a tradeskilling disaster.
Manual "install" Changes?
I am assisting in the further research of EQ2 on Linux / Steam, here, the implementation of eq2maps for EQ2. also, the default directory for EQ2 under Steam is: ... create a file named EQ2.ini also within EQ2 directory which contains (just?) the following lines: ...
Expansions
With your DAYBREAK ALL ACCESS MEMBERSHIP get monthly 500 Daybreak Cash, 10% off Marketplace purchases †, and member benefits in EverQuest, EverQuest II, DC Universe Online, and PlanetSide 2. US Dollars. Access to all previous expansion content included. With your purchase you will also receive access to these expansions' content.
EverQuest 2 Forums
EQ2 API. Threads 0 Messages 0. Sub-forums. Sub-forums. Developer Announcements Threads 0 Messages 0. None. Special Ruleset Server Discussions. General TLE Discussions. Threads 42 Messages 577. Threads 42 Messages 577. D. Tradeskill costs (pls fix) Anashti Sul - server. 19 minutes ago; Drekevec; PvP TLE Discussions. Threads 6 Messages 78.
Traveling Researchers
So, the traveling researchers are going to be needed for at least one more step in the epic spell quest lines, and I would like to try to figure out how they are spawning. If you could please post below when you see them spawn on your server (With timezone and which researchers, please) I will collate the data and attempt to figure out the pattern.
EQ2U
EQ2U - Item Details - Recuso Field Voucher. June 19, 2024 -- The new Anashti Sul server on the 2006 "Origins" EQ2 ruleset is now live. Sadly, there are no plans for it to support Census. Adventure Report (on some pages called Kunark Ascending Report) has been updated to cover 16 of the 21 expansions AND now has tooltips you can hover over each ...
Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient
Real-time qPCR results of nasal swabs (Laboklin and VCM analyses) Initially, the first three horses showing clinical signs of respiratory disease (Eq1, Eq2 and Eq3) all tested positive for EHV-4 (Fig. 1), EHV-5 and Streptococcus equi subspecies zooepidemicus.Additional four horses tested EHV-4 positive after 4-5 days (Eq4, Eq5, Eq6 and Eq7), and the last two horses (Eq8 and Eq9), tested ...
Ballads of Zimara Advancement Research Material 30 mins
For what it's worth, the unlock for the Collection and Advancement researchers are both account wide. Granted, only one collection piece can be researched on your account at a time, but every toon can research an item on the Advanced Researcher at all times. (But you have to be 130 to research the unattuner) Zylara likes this.
Buildings
However, the dynamic behavior of TLDs and their interaction with structures is complex. While most research on TLDs has focused on mitigating wind-induced vibrations, less attention has been paid to their seismic control of structural responses. ... This aspect is further confirmed by Zhu et ... EQ2 (i.e., Nahanni 1985), as shown above, has a ...
Fixed Internally Unable to claim researched mount
This issue is because you bought a CE or PE version and upgraded your claimed mount, which automatically granted you some levels of mount research. Since you were already researching T1, it didn't cancel it or prevent you starting it, but you cannot claim it because your account is already flagged for it. You need to hit 'Stop' and move on to ...